Đề tài Chuẩn đoán vi khuẩn E. Coli nhóm stec bằng kỹ thuật gen

Vi sinh vật nói chung và vi khuẩn nói riêng giữ vai trò rất quan trọng trong mọi hệ sinh thái. Chúng tồn tại khắp nơi ngay cả trong cơ thể của các sinh vật khác. Đa số các loài vi khuẩn có lợi được ứng dụng trong sản xuất các chế phẩm phục vụ cho vật nuôi và con người. Một số ít lại là nguyên nhân gây bệnh. Điều này thúc đẩy các kỹ thuật chẩn đoán vi khuẩn ra đời. Thông thường trong chẩn đoán vi khuẩn thường áp dụng kỹ thuật nuôi cấy phân lập trên một số môi trường chuyên biệt và xác định vi khuẩn thông qua các phản ứng sinh hóa Quy trình chẩn đoán xét nghiệm này có ưu điểm là đơn giản nhưng lại không đảm bảo tính chính xác của kết quả cũng như không cho thấy những mối liên hệ về mặt di truyền, sự biến chủng của vi khuẩn theo thời gian. Các kỹ thuật sinh học phân tử, kỹ thuật gen, kỹ thuật chẩn đoán dựa trên cấu trúc gen của vi khuẩn như kỹ thuậtPCR, Real-time PCR, PCR-RFLP với những ưu điểm nổi trội như nhanh, nhạy, chính xác đã thay thế rất tốt cho các phương pháp chẩn đoán cổ điển trong các trường hợp xảy ra ổ dịch, nhất là đối với các loại vi khuẩn khó nuôi cấy và chẩn đoán như vi khuẩn lao, Leptospira hoặc những vi khuẩn gây ngộ độc thực phẩm như Salmonella, E. Colinhóm STEC.

pdf18 trang | Chia sẻ: lvbuiluyen | Ngày: 02/11/2013 | Lượt xem: 1698 | Lượt tải: 5download
Bạn đang xem nội dung tài liệu Đề tài Chuẩn đoán vi khuẩn E. Coli nhóm stec bằng kỹ thuật gen, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Sinh vieõn : Lửụng Theỏ Thũnh MSSV : 05126112 1 I. ẹAậT VAÁN ẹEÀ Vi sinh vaọt noựi chung vaứ vi khuaồn noựi rieõng giửừ vai troứ raỏt quan troùng trong moùi heọ sinh thaựi. Chuựng toàn taùi khaộp nụi ngay caỷ trong cụ theồ cuỷa caực sinh vaọt khaực. ẹa soỏ caực loaứi vi khuaồn coự lụùi ủửụùc ửựng duùng trong saỷn xuaỏt caực cheỏ phaồm phuùc vuù cho vaọt nuoõi vaứ con ngửụứi. Moọt soỏ ớt laùi laứ nguyeõn nhaõn gaõy beọnh. ẹieàu naứy thuực ủaồy caực kyừ thuaọt chaồn ủoaựn vi khuaồn ra ủụứi. Thoõng thửụứng trong chaồn ủoaựn vi khuaồn thửụứng aựp duùng kyừ thuaọt nuoõi caỏy phaõn laọp treõn moọt soỏ moõi trửụứng chuyeõn bieọt vaứ xaực ủũnh vi khuaồn thoõng qua caực phaỷn ửựng sinh hoựa… Quy trỡnh chaồn ủoaựn xeựt nghieọm naứy coự ửu ủieồm laứ ủụn giaỷn nhửng laùi khoõng ủaỷm baỷo tớnh chớnh xaực cuỷa keỏt quaỷ cuừng nhử khoõng cho thaỏy nhửừng moỏi lieõn heọ veà maởt di truyeàn, sửù bieỏn chuỷng cuỷa vi khuaồn theo thụứi gian. Caực kyừ thuaọt sinh hoùc phaõn tửỷ, kyừ thuaọt gen, kyừ thuaọt chaồn ủoaựn dửùa treõn caỏu truực gen cuỷa vi khuaồn nhử kyừ thuaọt PCR, Real-time PCR, PCR-RFLP… vụựi nhửừng ửu ủieồm noồi troọi nhử nhanh, nhaùy, chớnh xaực ủaừ thay theỏ raỏt toỏt cho caực phửụng phaựp chaồn ủoaựn coồ ủieồn trong caực trửụứng hụùp xaỷy ra oồ dũch, nhaỏt laứ ủoỏi vụựi caực loaùi vi khuaồn khoự nuoõi caỏy vaứ chaồn ủoaựn nhử vi khuaồn lao, Leptospira… hoaởc nhửừng vi khuaồn gaõy ngoọ ủoọc thửùc phaồm nhử Salmonella, E. Coli nhoựm STEC. 2 II. TOÅNG QUAN II.1. Trửùc khuaồn Escherichia coli: Escherichia coli laứ moọt loaùi trửùc khuaồn soỏng thửụứng xuyeõn trong ruoọt ngửụứi vaứ moọt soỏ ủoọng vaọt ủửụùc Eschrich phaựt hieọn ra tửứ naờm 1885. Chuựng chieỏm tụựi 80% vi khuaồn hieỏu khớ soỏng ụỷ ruoọt. Bỡnh thửụứng chuựng khoõng gaõy beọnh, khi cụ theồ suy yeỏu moọt soỏ chuỷng coự khaỷ naờng gaõy beọnh. Vi khuaồn E. Coli thuoọc hoù trửùc truứng ủửụứng ruoọt (Enterobacteriacae). ễÛ trong ruoọt chuựng soỏng ủoỏi khaựng vụựi moọt soỏ vi khuaồn khaực nhử Salmonella vaứ Shigella (Thửụng haứn vaứ lợ) nhụứ coự khaỷ naờng taùo ra moọt loaùi chaỏt ửực cheỏ coự teõn laứ Colixin. Chuựng coứn coự khaỷ naờng toồng hụùp moọt soỏ vitamin thuoọc nhoựm B, E vaứ K. Vỡ theỏ khi khoõng gaõy beọnh chuựng coự lụùi cho ủửụứng ruoọt nhụứ haùn cheỏ ủửụùc moọt soỏ vi khuaồn gaõy beọnh khaực, giửừ theỏ caõn baống sinh thaựi trong ruoọt vaứ sinh toồng hụùp moọt soỏvitamin. E. Coli ủửụùc thaỷi ra moõi trửụứng theo phaõn, do chieỏm tụựi 80% vi khuaồn hieỏu khớ trong ruoọt vaứ luoõn giửừ theỏ caõn baống sinh thaựi neõn E. Coli ủửụùc choùn laứm vi sinh vaọt chổ thũ oõ nhieóm. 3 II.1.1 ẹaởc ủieồm sinh hoùc cuỷa E. Coli: a) ẹaởc ủieồm hỡnh thaựi & caỏu taùo: E. Coli coự hỡnh que, hai ủaàu troứn, kớch thửụực daứi ngaộn khaực nhau, thửụứng tửứ 2 – 3 micromet x 0,5 micromet. Thửụứng ủửựng rieõng reừ tửứng teỏ baứo, cuừng coự khi gheựp tửứng ủoõi moọt, coự khi keỏt vụựi nhau thaứnh tửứng ủaựm hoaởc moọt chuoói ngaộn. Thửụứng coự tieõm mao moùc khaộp beà maởt,coự khaỷ naờng di ủoọng. Khoõng coự khaỷ naờng hỡnh thaứnh baứo tửỷ, coự khaỷ naờng hỡnh thaứnh giaựp maùc (voỷ nhaứy) khi gaởp moõi trửụứng dinh dửụừng toỏt. Nhuoọm gram aõm. b) Tớnh chaỏt nuoõi caỏy: Deó nuoõi caỏy, pH thớch hụùp 7 – 7,2, nhieọt ủoọ thớch hụùp 37oC. E. Coli coự phaỷn ửựng ủoỷ Methyl dửụng tớnh. E. Coli coự khaỷ naờng sinh Indol. c) Sửực ủeà khaựng: E. Coli deó bũ tieõu dieọt bụỷi caực thuoỏc saựt truứng thoõng thửụứng, sửực ủeà khaựng yeỏu. E. Coli thửụứng bũ tieõu dieọt ụỷ nhieọt ủoọ 60oC trong 30 phuựt. Deó bũ tieõu dieọt bụỷi caực thuoỏc saựt truứng thoõng thửụứng. 4 II.1.2 Khaỷ naờng gaõy beọnh: Bỡnh thửụứng E. Coli soỏng trong ruoọt ngửụứi khoõng gaõy beọnh. Khi cụ theồ suy yeỏu moọt soỏ chuỷng trụỷ neõn gaõy beọnh. E. Coli khoõng nhửừng chổ gaõy beọnh ủửụứng ruoọt nhử tieõu chaỷy, kieỏt lợ maứ coứn coự theồ gaõy moọt soỏ beọnh khaực nhử vieõm ủửụứng tieỏt nieọu, vieõm gan, vieõm pheỏ quaỷn, vieõm maứng phoồi, v…v… ẹoọc toỏ cuỷa E. Coli thuoọc loaùi noọi ủoọc toỏ, coự khaỷ naờng chũu nhieọt. ẹaởc bieọt coự moọt soỏ chuỷng ủoọt bieỏn coự khaỷ naờng sinh ngoaùi ủoọc toỏ, coự khaỷ naờng taực ủoọng leõn teỏ baứo thaàn kinh. Caựi teõn EHEC ủửụùc aựp duùng ủoỏi vụựi Vi khuaồn Verotoxigenic E. Coli (VTEC), coự lieõn quan ủeỏn beọnh vieõm thaứnh ruoọt keỏt ụỷ ngửụứi. Verotoxin laứ ủoọc toỏ cuỷa E. Coli gaõy cheỏt teỏ baứo Vero. Nhửừng ủoọc toỏ naứy gaàn gioỏng vụựi ủoọc toỏ Shiga, ủửụùc taùo ra tửứ Shigella dysenteriae, vaứ vỡ vaọy chuựng cuừng ủửụùc goùi laứ ủoọc toỏ gioỏng Shiga (Shiga-like toxin). ẹoọc toỏ Verotoxin chửựa 2 nhoựm: VT-1 (Shiga-like toxin I [SLT-I]) vaứ VT-2 (Shiga-like toxin II [SLT-II]). 5 Yeỏu toỏ ủoọc lửùc cuỷa nhoựm STEC bao goàm enzyme haemolysin phaự huỷy hoàng caàu (gen Hly), yeỏu toỏ keỏt baựm Intimin (gen eae), ủoọc toỏ SLT-I hay VT1 hoaởc stx1 (gen stx1), ủoọc toỏ SLT-II hay VT2 hoaởc stx2 (gen stx2), ủoọc toỏ SLT- Iie hay VT2e hoaởc stx2e (gen stx2e)… caực loaùi ủoọc toỏ cuỷa STEC coự tớnh chaỏt sinh hoùc tửụng ủoỏi gioỏng nhau, ủeàu cuứng coự khaỷ naờng phaự huỷy teỏ baứo Vero vỡ vaọy vieọc phaõn bieọt ủửụùc chuựng cuừng khoõng ủụn giaỷn, ủoứi hoỷi caực phửụng tieọn chaồn ủoaựn hieọn ủaùi: Nuoõi caỏy teỏ baứo hoaởc ELISA xaực ủũnh ủoọc toỏ stx; PCR, lai xaực ủũnh gen eae, VT1, VT2…; RFLP, PFGE phaõn bieọt kieồu gen… II.1.3 Caực phửụng phaựp chaồn ủoaựn E. Coli: Cuừng gioỏng nhử vi khuaồn Salmonella, sửù phaõn loaùi vaứ chaồn ủoaựn vi khuaồn E. Coli theo type khaựng nguyeõn laứ khaự phửực taùp,dửùa theo 3 loaùi khaựng nguyeõn beà maởt chớnh laứ: Khaựng nguyeõn thaõn O, khaựng nguyeõn loõng roi H vaứ khaựng nguyeõn capsul K. Trong phaõn laọp vi khuaồn STEC, ngửụứi ta thửụứng sửỷ duùng moõi trửụứng sorbito-MacConkey agar (SMAC) hoaởc moõi trửụứng SMAC boồ sung cefixime vaứ potassium tellurite (CT-SMAC). Tuy nhieõn vieọc phaõn laọp vi khuaồn treõn 2 moõi trửụứng naứy cho pheựp phaựt hieọn chuỷ yeỏu vi khuaồn STEC thuoọc serotype O157, trong khi ủoự coứn khoõng ớt STEC khoõng thuoọc serotype O17 vaứ coự tớnh chaỏt leõn men ủửụứng sorbitol raỏt bieỏn ủoồi. Keỏt quaỷ phaõn laọp STEC treõn 2 moõi 6 trửụứng SMAC vaứ CT-SMAC chổ phuứ hụùp tửứ 30-80% keỏt quaỷ chaồn ủoaựn ủoọc toỏ stx treõn moõi trửụứng teỏ baứo Vero. Xeựt veà tớnh chaỏt sinh hoựa, vi khuaồn O157:H7 STEC phaàn lụựn khoõng saỷn sinh ủửụùc enzyme β-D-glucuronidase, do vaọy coự theồ duứng tớnh chaỏt naứy ủeồ sụ boọ ủaựnh giaự sửù nhieóm O157:H7 STEC. Coự theồ chaồn ủoaựn E. Coli O157 baống kyừ thuaọt mieón dũch huyứnh quang trửùc tieỏp vụựi vieọc sửỷ duùng khaựng theồ ủa doứng khaựng O157 gaộn fluorescein isothiocyanate vụựi thụứi gian xeựt nghieọm chổ caàn khoaỷng 2 giụứ. Kyừ thuaọt ELISA trửùc tieỏp cuừng cho pheựp phaựt hieọn vi khuaồn E. Coli O157 trong maóu vụựi thụứi gian raỏt ngaộn, chổ trong voứng 1 giụứ. Tuy caỷ 2 kyừ thuaọt: Kyừ thuaọt mieón dũch huyứnh quang trửùc tieỏp vaứ ELISA trửùc tieỏp ủeàu coự ủoọ nhaùy tửụng ủửụng vụựi vieọc phaõn laọp treõn moõi trửụứng SMAC vaứ CT-SMAC nhửng caàn phaỷi khaỳng ủũnh sửù hieọn dieọn cuỷa ủoọc toỏ stx trong maóu. ẹieàu naứy ủửụùc thửùc hieọn qua kyừ thuaọt PCR-RFLP. 7 II.2 Phửụng phaựp: II.2.1 Nhaọn dieọn STEC (VTEC) baống kyừ thuaọt PCR: a) Xửỷ lyự maóu: Maóu phaõn ủửụùc loùc nửụực vaứ xửỷ lyự vụựi phosphate-buffered saline (PBS) vaứ ủửụùc kieồm tra ủoọ loaừng ủeồ ủaỷm baỷo hoaùt tớnh cuỷa ủoọc toỏ coự taực duùng treõn lụựp ủụn teỏ baứo Vero. b) Quaự trỡnh thửùc hieọn: ™ Primers Qua vieọc xaực ủũnh gen ủoọc lửùc cuỷa nhoựm STEC (gen stx), ngửụứi ta coự theồ nhaọn dieọn ủửụùc chuựng. Kyừ thuaọt naứy sửỷ duùng 2 caởp moài tửụng ửựng khuyeỏch ủaùi cho 2 gen VT-1 vaứ VT-2: ) Theo baựo caựo cuỷa Karam Ramotar vaứ coọng sửù naờm1995: VT-1 Primer GAAGAGTCCGTGGGATTACG AGCGATGCAGCTATTAATAA VT-2 Primer TTAACCACACCCACGGCAGT GCTCTGGATGCATCTCTGGT Trong ủoự: VT-1 Primers duứng khuyeỏch ủaùi 130 caởp Nu (Tửứ Nu 1191 – 1320 cuỷa gen VT-1) VT-2 Primers duứng khuyeỏch ủaùi 346 caởp Nu (Tửứ Nu 426 – 771 cuỷa gen VT-2) 8 ) Theo baựo caựo cuỷa L. Mansouri-Najand vaứ M. Khalili naờm 2007: ™ Vaọt lieọu: Hoón hụùp thửùc hieọn PCR chửựa: - 5 μl Buffer - 50 mM KCL - 0,01 % gelatin - 10 mM Tris-HCL (pH 8.3) - 2,5 mM MgCl2 - 0,2 mM tửứng loaùi dNTP - 0,001 mM từng loại Primers - 1 μl ADN khuoõn - Phaỷn ửựng PCR baột ủaàu vụựi 2.5 U Tag polymerase 9 ™ Phaỷn ửựng: - Khụỷi ủaàu laứ bieỏn tớnh ADN ụỷ 95oC trong 5 phuựt - 40 chu kỡ sau dieón ra vụựi chu trỡnh nhieọt: 94oC trong 1 phuựt, 55oC trong 1 phuựt, 72oC trong 1 phuựt - Chu kỡ cuoỏi giửừ 72 oC trong 7 phuựt Saỷn phaồm khuyeỏch ủaùi tửứ phaỷn ửựng PCR sau ủoự ủửụùc ủieọn di treõn gel Agarose 2% vaứ ủửụùc nhuoọm vụựi Ethidium bromide. 10 II.2.2 ệÙng duùng kyừ thuaọt PCR-RFLP trong chaồn ủoaựn vi khuaồn E.Coli nhoựm STEC (Shiga-like toxin Escherichia coli): Saỷn phaồm khueỏch ủaùi cuỷa phaỷn ửựng PCR coự theồ ủửụùc sửỷ duùng ủeồ duứng trong kyừ thuaọt RFLP ủeồ xaực ủũnh caực chuỷng trong nhoựm STEC. Kyừ thuaọt RFLP tieỏn haứnh treõn cụ sụỷ sửỷ duùng caực enzyme caột khaực nhau keỏt hụùp vụựi caực trỡnh tửù ADN ủửụùc caột cuừng khaực nhau (trỡnh tửù ADN khaực nhau laứ saỷn phaồm cuỷa phaỷn ửựng PCR trửụực ủoự). Keỏt quaỷ laứ thu nhaọn ủửụùc saỷn phaồm caột khaực nhau (mang tớnh ủa hỡnh). Vaứ nhử vaọy cho pheựp phaõn bieọt ủửụùc caực caự theồ vụựi nhau. Thoõng thửụứng trong kyừ thuaọt PCR ủeồ chaồn ủoaựn vi khuaồn nhoựm STEC ngửụứi ta sửỷ duùng caực caởp moài xaực ủũnh gen stx1 vaứ stx2, tuy nhieõn ủeồ chaồn ủoaựn moọt soỏ vi khuaồn ủaởc bieọt thuoọc nhoựm STEC ngửụứi ta sửỷ duùng theõm nhửừng caởp moài cho pheựp xaực ủũnh caực gen eae, stx2e … vaứ caực bieỏn theồ cuỷa chuựng. Những dũng E. Coli được tỡm thấy đều tạo độc tố verotoxin (VT) hoặc Shiga-like toxin (SLT). Cú 3 loại riờng biệt: VT-1 (SLT-1), VT-2 (SLT-2), và Vte (là biến thể của VT-2: SLT-IIv). Dũng E. Coli O91:H21 được nghiờn cứu là sản xuất ra độc tố này. Sau khi giải trỡnh tự và dũng húa dũng vi khuẩn này, ta xỏc định được 2 gen riờng biệt mó húa cho 2 độc tố đặc tớnh tương tự như VT-2. Gen thứ nhất gọi là vtx2ha mó húa cho độc tố VT2v-a, gen thứ hai gọi là vtx2hb mó húa cho độc tố VT2v-b 11 ™ Caựch thửùc hieọn: Chẩn đoỏn gen tiểu phần B biến thể của Verotoxin loại 2 (VT2v-b): B1: Chọn dũng vi khuẩn trong bảng sau: 12 B2: Thực hiện phản ứng PCR như trỡnh bày ở trờn thờm một số cặp mồi: Trong ủoự: VT2-c & VT2-d laứ primers ủaởc trửng cho VT2 vaứ bieỏn theồ VT2; VT2v-1 & VT2v-2 laứ primers ủaởc trửng cho bieỏt theồ VT2 B3: Sử dụng Enzyme cắt giới hạn: ẹoỏi vụựi chuỷng O157 coự theồ duứng caực RE: XbaI, AvrII, SpeI. 13 B4: ẹieọn di: Nhửừng trỡnh tửù ADN ủửụùc khuyeỏch ủaùi sau phaỷn ửựng PCR sau khi ủửụùc caột bụỷi enzyme caột giụựi haùn seừ taùo ra nhieàu trỡnh tửù ADN nhoỷ ủaởc trửng cho tửứng loaùi vaứ ủửụùc xaực ủũnh qua phửụng phaựp ủieọn di gel agarose 2%. RFLP cuỷa saỷn phaồm PCR chaồn ủoaựn gen VT2 (stx2) (A) Duứng enzyme caột HaeIII (B) Duứng enzyme caột RsaI (C) Duứng enzyme caột Nci a: Thang chuaồnI b, c, d, e, f, g: caực chuỷng E.Coli 14 B5: Nhuoọm baùc theo phửụng phaựp cuỷa Sambrook vaứ coọng sửù thu nhaọn keỏt quaỷ. ™ ệu ủieồm cuỷa kyừ thuaọt PCR-RFLP: - Do tớnh chaỏt chuyeõn bieọt raỏt cao cuỷa enzyme caột neõn kyừ thuaọt naứy cho pheựp xaực ủũnh sửù tửụng ủoàng hoaởc khaực bieọt raỏt nhoỷ giửừa caực doứng vi khuaồn hoaởc virus. - Coự theồ xaực ủũnh nguoàn goỏc caờn beọnh ụỷ caực oồ dũch khoõng chổ trong phaùm vi moọt vuứng maứ caỷ toaứn theỏ giụựi. - Coự theồ keỏt hụùp vụựi kyừ thuaọt lai trong chaồn ủoaựn caực taực nhaõn gaõy beọnh. ™ Khuyeỏt ủieồm: - Kyừ thuaọt naứy khoõng cho pheựp phaõn bieọt caực chuỷng vi sinh vaọt neỏu sửù bieỏn ủoồi gen cuỷa chuựng xaỷy ra ngoaứi vũ trớ caột ủaởc hieọu. 15 III. KEÁT LUAÄN: Chaồn ủoaựn ủửụùc vi khuaồn E.Coli nhoựm STEC baống kyừ thuaọt PCR-RFLP thoõng qua gen ủoọc toỏ cuỷa tửứng chuỷng. Xaực ủũnh ủửụùc caực bieỏn theồ ủoọc toỏ cuỷa vi khuaồn nhoựm STEC 16 IV. TAỉI LIEÄU THAM KHAÛO Coõng ngheọ Sinh hoùc trong thuự y (Nguyeón Ngoùc Haỷi) Giaựo trỡnh Vi sinh vaọt hoùc moõi trửụứng (Traàn Caồm Vaõn) Identification of Verotoxin Type 2 Variant B Subunit gens in E.Coli by PCR and RFLP (S.D Styler vaứ coọng sửù - Taọp 29, soỏ 7) Direct Detection of Verotoxin-Producing Escherichia coli in Stool Samples by PCR (KaRam Ramotar vaứ coọng sửù – Taọp 33, soỏ 3) Typing of Bovine Attaching and Effacing Escherichia coli by Multiplex in vitro amplification of Virulence-Associated genes (Bernard China et al – Taọp 62, soỏ 9)   17 I. ẹAậT VAÁN ẹEÀ II. TOÅNG QUAN II.1 Trửùc khuaồn Escherichia coli E. Coli ...................................................3 II.1.1 ẹaởc ủieồm sinh hoùc cuỷa E. Coli.......................................................4 II.1.2 Khaỷ naờng gaõy beọnh ........................................................................5 II.1.3 Caực phửụng phaựp chaồn ủoaựn E. Coli..............................................6 II.2 Phửụng phaựp.........................................................................................7 II.2.1 Nhaọn dieọn STEC (VTEC) baống kyừ thuaọt PCR...............................8 II.2.2 ệÙng duùng kyừ thuaọt PCR-RFLP trong chaồn ủoaựn vi khuaồn E.Coli nhoựm STEC (Shiga-like toxin Escherichia coli)....................................11 III. KEÁT LUAÄN IV. TAỉI LIEÄU THAM KHAÛO
Luận văn liên quan