Luận văn Nghiên cứu tính đa dạng di truyền của quần thể Thông đỏ tại Lâm Đồng bằng kỹ thuật sinh học phân tử

Để phát hiện sự đa hình, 08mồisau sàng lọcđã được sử dụng trong phản ứng PCR trên DNA genome thu được từ các mẫu lá của 50 cây thông đỏ. Sản phẩm khuếch đại tạo ra từ những mồinày được phân tách bằng điện di 130phút, 90 voltage trên gel polyacrylamide10%, nhuộm ethidium bromidevà hiển thị dưới đèn UV. Kết quả tổng hợp trong Bảng 3.1cho thấy tổng số băng khuyếch đại thu được sau phản ứng PCR là 66 . Như vậy, trung bình mỗi mồi khuyếch đại được8.25 băng. Số băng khuy ếch đại được từ các mồi dao động trong khoảng 7-11băng. Có63 trong số 66 băng là đa hình, chiếmtỉ lệ 95.31%. Tỉ lệ băng đa h ình dao độngtrong khoảng 75% -100%giữa các mồi.

pdf17 trang | Chia sẻ: tuandn | Ngày: 30/01/2013 | Lượt xem: 1488 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Luận văn Nghiên cứu tính đa dạng di truyền của quần thể Thông đỏ tại Lâm Đồng bằng kỹ thuật sinh học phân tử, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
-29- Kết quả & Bàn luận 3. KẾT QUẢ & BÀN LUẬN 3.1 Đa dạng di truyền thông đỏ Lâm Đồng qua khảo sát bằng kỹ thuật RAPD 3.1.1 Kết quả đa hình thu được sau phản ứng RAPD-PCR 3.1.1.1 Sàng lọc mồi Sử dụng 9 mẫu ngẫu nhiên gồm BD1, BD2, BD3, TQ, XT, NV1, NV2, NV3, NV4 cho phản ứng RAPD-PCR với 27 mồi 10-mer oligonucleotide để sàng lọc các mồi hữu hiệu dùng cho nghiên cứu. Một số mồi có sẵn trong phòng thí nghiệm và số khác được tham khảo từ tác giả Collins [26]. Hầu hết 27 mồi đều cho kết quả đa hình trên 9 mẫu. Tuy nhiên, chỉ có 08 mồi: OPA-07, OPA-12, OPC-06, OPN-09, OPP-04, OPX-04, OPX-14, OPX-15 cho kết quả với các băng phân biệt rõ, riêng biệt, nên được chọn để sử dụng cho phản ứng RAPD-PCR trên toàn bộ 50 mẫu nghiên cứu. 3.1.1.2 Kết quả khuyếch đại DNA với mồi ngẫu nhiên Để phát hiện sự đa hình, 08 mồi sau sàng lọc đã được sử dụng trong phản ứng PCR trên DNA genome thu được từ các mẫu lá của 50 cây thông đỏ. Sản phẩm khuếch đại tạo ra từ những mồi này được phân tách bằng điện di 130 phút, 90 voltage trên gel polyacrylamide 10%, nhuộm ethidium bromide và hiển thị dưới đèn UV. Kết quả tổng hợp trong Bảng 3.1 cho thấy tổng số băng khuyếch đại thu được sau phản ứng PCR là 66. Như vậy, trung bình mỗi mồi khuyếch đại được 8.25 băng. Số băng khuyếch đại được từ các mồi dao động trong khoảng 7-11 băng. Có 63 trong số 66 băng là đa hình, chiếm tỉ lệ 95.31%. Tỉ lệ băng đa hình dao động trong khoảng 75% - 100% giữa các mồi. -30- Kết quả & Bàn luận Tuy tỉ lệ băng đa hình cao, nhưng không mồi nào có thể được sử dụng làm marker để nhận diện các mẫu khác nhau từ các quần thể khác nhau. Ngoại trừ mồi OPA-07 có ba băng chỉ xuất hiện duy nhất một lần, đó là băng 490 bp trên mẫu NV25 (số 39), băng 400 bp trên mẫu TQ (số 13) và băng 280 bp trên mẫu HT7 (số 07). Các băng này có thể sử dụng làm marker để phân biệt ba mẫu trên với các mẫu còn lại. Bảng 3.1: Kết quả RAPD của 50 mẫu thông đỏ với tám mồi chọn lọc. Tên mồi Trình tự Tổng Số băng Tỉ lệ băng đa OPA-7 5’-GAAACGGGTG-3’ 10 10 100 OPA-12 5’-TCGGCGATAG-3’ 7 7 100 OPC-6 5’-GAACGGACTC-3’ 7 7 100 OPN-9 5’-TGCCGG CTTG-3’ 8 8 100 OPP-4 5’-GTGTCTCAGG-3’ 8 7 87.5 OPX-4 5’-CCGCTACCGA-3’ 11 11 100 OPX-14 5’-ACAGGTGCTG-3’ 7 7 100 OPX-15 5’-CAGACAAGCC-3’ 8 6 75 Tổng cộng 66 63 Trung bình 8.25 7.88 95.31 -31- Kết quả & Bàn luận Hình 3.1: Sản phẩm RAPD-PCR với mồi OPA-07 Hình 3.2: Sản phẩm RAPD-PCR với mồi OPA-12 -32- Kết quả & Bàn luận Hình 3.3: Sản phẩm RAPD-PCR với mồi OPC-06 Hình 3.4: Sản phẩm RAPD-PCR với mồi OPN-09 -33- Kết quả & Bàn luận Hình 3.5: Sản phẩm RAPD-PCR với mồi OPP-04 Hình 3.6: Sản phẩm RAPD-PCR với mồi OPX-04 -34- Kết quả & Bàn luận Hình 3.7: Sản phẩm RAPD-PCR với mồi OPX-14 Hình 3.8: Sản phẩm RAPD-PCR với mồi OPX-15 -35- Kết quả & Bàn luận 3.1.2 Tương quan di truyền giữa các mẫu khảo sát dựa trên hệ số tương ứng đơn giản (SM coefficient) Tương quan di truyền giữa các mẫu được tính toán bằng phần mềm NTSYS-pc 2.1 dựa trên hệ số tương ứng đơn giản SM (Simple matching coefficient). Kết quả Bảng B, phần phụ lục, cho thấy 50 mẫu khảo sát tạo thành 1225 cặp, với hệ số tương quan di truyền từng cặp nằm trong khoảng 44% – 92%. Trung vị (median) tính được là 70%. 615/1225 cặp có hệ số tương quan thấp hơn 70% và 610/1225 cặp có hệ số tương quan từ 70% trở lên. Hệ số tương quan di truyền xuất hiện với tần suất nhiều nhất (mode) là 68%, với 100/1225 cặp. Cặp mẫu khác nhau nhiều nhất là HT7 & NV16 (44%) và cặp tương đồng nhiều nhất là NV21 và NV22 (92%). HT5 và NV16 là hai mẫu có hệ số tương quan di truyền thấp nhất (khoảng cách di truyền xa nhất) so với toàn bộ mẫu khảo sát. HT5 tạo ra các hệ số tương quan di truyền trong khoảng 45% - 68% với 49 mẫu còn lại. NV16 tạo ra các hệ số tương quan di truyền trong khoảng 44% - 70%. Ba mẫu từ Bidoup tạo ra 3 hệ số tương quan di truyền 85%, 73% và 79% tương ứng giữa từng cặp BD1 & BD2, BD1 & BD3 và BD2 & BD3. Điều đó cho thấy có nhiều khác biệt giữa BD3 khi so với BD1&BD2. 08 mẫu từ Hồ Tiên tạo ra 28 hệ số tương quan di truyền trong khoảng 47% - 86%, xa nhau nhất là HT5 & HT7 (47%), gần nhất là hai mẫu HT3 & HT4 (86%). HT5 là mẫu có tương quan di truyền thấp nhất với các mẫu còn lại, với hệ số tương quan di truyền trung bình chỉ ở mức 56%. 36 mẫu từ Núi Voi có hệ số tương quan di truyền trong khoảng 50% - 92%, xa nhau nhất (50%) là hai cặp mẫu NV2 & NV16, NV14 & NV16, và gần nhau nhất là cặp mẫu NV21 & NV22 (92%). Mẫu TQ được xem là T. chinensis có hệ số tương quan di truyền với các mẫu còn lại từ Lâm Đồng ở mức trung bình, trong khoảng 52% - 67%. -36- Kết quả & Bàn luận Kết quả phân tích của NTSYS bên trên cho thấy hầu hết các mẫu khảo sát khá gần nhau về khoảng cách di truyền. Điều này cũng hoàn toàn hợp lý vì đa số các mẫu đều được thu thập từ các vùng rừng núi của Lâm Đồng – nơi mà theo ghi nhận của các nhà Lâm học nước ta là chỉ có sự tồn tại của một loài thông đỏ, thông đỏ nam – Taxus wallichiana Zucc. Thêm vào đó, thông đỏ là cây gỗ lâu năm, thụ phấn nhờ gió, hạt được phát tán nhờ động vật, nên về lý thuyết chúng sẽ không có tính đa dạng cao về mặt di truyền. Tính đa dạng di truyền thấp cũng được các nhà khoa học trên thế giới công bố đối với các quần thể Taxus khác như T. wallichiana vùng Đông Bắc Ấn Độ [56], T. wallichiana khu vực phía tây Himalaya [45], T. fuana vùng Pakistan [58], khi sử dụng các marker phân tử RAPDs và AFLP. 3.1.3 Phân nhóm di truyền các mẫu thông đỏ khảo sát Ma trận hệ số tương quan di truyền được dùng làm dữ liệu đầu vào để xếp nhóm cho 50 mẫu khảo sát, sử dụng phần mềm NTSYS-pc 2.1, theo phương pháp SAHN. Kết quả thu được ở Bảng 3.2 và Hình 3.9 cho thấy nếu xét ở mức độ 60% tương quan di truyền thì toàn bộ mẫu khảo sát tạo ra một nhóm lớn với 47 mẫu, một nhóm nhỏ với hai mẫu TQ & NV16 và 1 mẫu đơn lẻ là HT5. Xét ở mức độ 68% tương quan di truyền thì 47 mẫu trong cùng một nhóm ở trên sẽ phân thành 2 nhóm A và B:  Nhóm A gồm 5 mẫu: HT6, NT, NV9, NV5, NV18  Nhóm B gồm toàn bộ 42 mẫu còn lại. Tuy nhiên, ở mức 69% tương quan di truyền thì nhóm B lại được phân thành hai nhóm nhỏ B1 và B2: o B1 là nhóm của 6 mẫu HT còn lại của quần thể Hồ Tiên. o B2 gồm 36 mẫu còn lại và tiếp tục phân nhánh thành 2 tiểu nhóm nhỏ ở mức 69.5%. Tiểu nhóm B2a chỉ chứa 2 mẫu NV14 và NV15. Tiểu nhóm B2b bao gồm 34 mẫu còn lại và chia thành 2 phân nhóm nhỏ B2b1 và B2b2 khi xét ở mức khoảng 70.5% tương quan di truyền. -37- Kết quả & Bàn luận Bảng 3.2: Sự phân nhóm di truyền của 50 mẫu khảo sát. Phân nhóm Nhóm Nhóm nhỏ Tiểu nhóm Tiểu nhóm nhỏ Mẫu I HT5 II TQ, NV16 A HT6, NT, NV9, NV5, NV18 B1 HT1, HT2, HT8, HT3, HT4, HT7 B2a NV14, NV15 B2b1 NV6, NV8, NV7, NV11, NV10, NV12, NV13 III B B2 B2b B2b2 BD1, BD2, XT, BD3, NV1, NV2, NV34, NV4, NV27, NV35, NV32, NV33, NV19, NV21, NV22, NV20, NV23, NV24, NV26, NV25, NV29, NV17, NV36, NV3, NV30, NV28, NV31 Tuy các mẫu khảo sát có tương quan di truyền cao, nhưng vẫn có sự phân nhóm giữa các mẫu được thu thập giữa các vùng khác nhau. Cụ thể là đa số các mẫu từ Hồ Tiên đều thuộc cùng 1 nhóm trong khi đa số các mẫu thu thập từ Núi Voi cũng tập hợp thành một nhóm khác. Kết quả này thể hiện khoảng cách di truyền giữa các mẫu trong cùng một vùng nhỏ hơn khoảng cách di truyền giữa các vùng địa lý với nhau. Kết quả này cho thấy có sự tương quan giữa khoảng cách địa lý và khoảng cách di truyền giữa các cá thể thông đỏ Lâm Đồng. -38- Kết quả & Bàn luận Coefficient 0.56 0.60 0.64 0.68 0.72 0.76 0.80 0.84 0.88 0.92 HT1 HT2 HT8 HT3 HT4 HT7 BD1 BD2 XT BD3 NV1 NV2 NV34 NV4 NV27 NV35 NV32 NV33 NV19 NV21 NV22 NV20 NV23 NV24 NV26 NV25 NV29 NV17 NV36 NV3 NV30 NV28 NV31 NV6 NV8 NV7 NV11 NV10 NV12 NV13 NV14 NV15 HT6 NT NV9 NV5 NV18 TQ NV16 HT5 Hình 3.9: Sơ đồ hình cây thể hiện mối tương quan về di truyền giữa 50 mẫu thông đỏ trên cơ sở kiểu gen III II I A B B 1 B 2 B 2a B 2b B 2b1 B 2b2 -39- Kết quả & Bàn luận 3.1.4 Tính đa dạng và cấu trúc di truyền của các quần thể được khảo sát Các mẫu khảo sát được thu thập ở 6 địa điểm khác nhau được xem là từ 6 quần thể khác nhau. Thuật ngữ “quần thể” ở đây không mang ý nghĩa là quần thể sinh học mà đơn thuần chỉ là những địa điểm khác nhau nơi các mẫu được thu thập. Trong số 6 quần thể khảo sát thì 3 quần thể chỉ thu duy nhất 1 cá thể, đó là NT (Vimedimex), XT (Xuân Trường) và TQ (Hòa Bình). Với 3 quần thể còn lại thì quần thể có số mẫu nhiều nhất là Núi Voi với 36 mẫu (NV1 – NV36), kế đến là Hồ Tiên với 8 mẫu (HT1 – HT8) và còn lại là Bidoup với 3 mẫu BD1, BD2, BD3. Hệ số đa dạng di truyền (Nei’s index) của quần thể (Hs) và của toàn bộ mẫu khảo sát (Ht) được tính cho từng mồi. Các hệ số này sau đó được sử dụng để tính mức độ biến động di truyền trong quần thể (Hs/Ht) và mức độ khác biệt về di truyền giữa các quần thể (Gst). Bảng 3.3: Các hệ số đa dạng di truyền dựa trên phân tích Nei về sự đa hình trong và giữa các quần thể thông đỏ. Mồi Ht Hs Hs/Ht Gst Nm OPX-04 0.3176 ± 0.0292 0.1298 ± 0.0038 0.4087 0.5914 0.3454 OPC-06 0.3692 ± 0.0253 0.1757 ± 0.0046 0.4759 0.5240 0.4543 OPA-07 0.2592 ± 0.0258 0.0797 ± 0.0045 0.3075 0.6925 0.2220 OPA-12 0.2583 ± 0.0292 0.1108 ± 0.0061 0.4290 0.5711 0.3756 OPP-04 0.1824 ± 0.0288 0.0884 ± 0.0028 0.4846 0.5155 0.4700 OPN-09 0.3817 ± 0.0172 0.1596 ± 0.0024 0.4181 0.5820 0.3591 OPX-14 0.2863 ± 0.0416 0.1205 ± 0.0053 0.4209 0.5789 0.3637 OPX-15 0.2931 ± 0.0426 0.1133 ± 0.0053 0.3866 0.6135 0.3150 Trung bình 0.2930 ± 0.0300 0.1207 ± 0.0048 0.4119 0.5881 0.3500 Chú thích: Trung bình hệ số di của quần thể (Hs) và của tổng thể mẫu khảo sát (Ht) theo từng mồi, độ khác biệt di truyền giữa các quần thể (Gst) và hệ số dòng chảy gen (Nm) -40- Kết quả & Bàn luận Kết quả Bảng 3.3 cho thấy hệ số đa dạng di truyền tổng thể tính được là 0.2930 (±0.0300), dao động trong khoảng 0.1824 (OPP-04) đến 0.3817 (OPN-09) giữa các mồi. Hệ số đa dạng di truyền tính theo quần thể là 0.1207 (±0.0048), dao động trong khoảng 0.0797 (OPA-07) đến 0.1757 (OPC-06) giữa các mồi. Biến động di truyền bên trong quần thể tính được là Hs/Ht = 41.99%, dao động trong khoảng từ 30.75% (OPA-07) đến 48.46% (OPP-04) giữa các mồi. Trong khi đó, mức độ khác biệt di truyền giữa các quần thể là Gst = 58.81%, dao động trong khoảng từ 51.55% (OPP-04) đến 69.25% (OPA-07) giữa các mồi. Hệ số dòng chảy gen trung bình cho toàn bộ mẫu trên 8 mồi là 0.3500, dao động trong khoảng từ 0.2220 (OPA-07) đến 0.4700 (OPP-04) giữa các mồi. Với Gst > Hs/Ht, sự đa dạng di truyền tính được giữa các quần thể thông đỏ Lâm Đồng lớn hơn sự đa dạng di truyền bên trong mỗi quần thể. Và đó chính là cấu trúc đa dạng di truyền của thông đỏ Lâm Đồng. Mức độ khác biệt di truyền giữa các quần thể T. wallichiana Lâm Đồng tính được là khá cao so với các loài cây giao phối cùng giống khác (Gst=0.22 hay 22%) và cao hơn so với các cây hạt trần khác (Gst=0.18 hay 18%) [58]. Mức khác biệt cao về mặt di truyền giữa các quần thể T. wallichiana này là bất thường so với các loài thân gỗ lâu năm, giao phối cùng giống, thụ phấn nhờ gió, và hạt được phân phối nhờ động vật có xương sống [36]. Tuy nhiên, điều này có thể được giải thích là do sự giới hạn của dòng chảy gen. Các quần thể thông đỏ Lâm Đồng phân bố không tập trung và phân tán rải rác trong các rừng nguyên sinh, nơi tốc độ và mức độ thổi của các cơn gió thấp. Từ đó dẫn đến khả năng phân tán hạt phấn thấp. Hệ số dòng chảy gen do đó cũng thấp [63]. Trong nghiên cứu này, hệ số dòng chảy gen tính được là Nm= 0.35. Điều này phù hợp với giả thiết bên trên và cho thấy phạm vi phân tán hạt phấn Taxus nhờ gió là không xa. 3.2 Đa dạng di truyền của thông đỏ Lâm Đồng qua khảo sát bằng kỹ thuật RFLP-PCR trên vùng trnL-trnF của DNA lục lạp (cpDNA) 3.2.1 Kết quả PCR-RFLP vùng giữa hai gen trnL-trnF -41- Kết quả & Bàn luận Kết quả PCR của toàn bộ 50 mẫu thông đỏ khảo sát với hai mồi trn-c và trn-f đều cho 1 vạch khuyếch đại ở vị trí khoảng 900 bp (Hình 3.10). Kết quả cắt với enzyme ApoI trên 50 mẫu đều cho kết quả giống nhau với 5 phân đoạn có kích thước khoảng 80 bp, 160 bp, 210 bp, 220 bp và 230 bp (Hình 3.11 A). Tương tự, kết quả cắt với enzyme XbaI cũng cho ra hai phân đoạn ở tất cả các mẫu, với kích thước mảnh khoảng 150 và 750 bp (Hình 3.11 B). Như thế, với 2 enzyme đã chọn là ApoI và XbaI, chúng tôi không thể khảo sát đa hình trên vùng trnL-trnF của cpDNA thông đỏ Lâm Đồng. Hình 3.10: Sản phẩm khuyếch đại vùng trnL-trnF trên cpDNA thông đỏ Hình 3.11: Sản phẩm cắt với enzyme cắt giới hạn ApoI (A) và XbaI (B). Chú thích: M: Thang chuẩn 100 bp của Biolabs; 01-08 là sản phẩm cắt từ vùng trnL-trnF của các mẫu thông đỏ khảo sát; NC là mẫu chứng âm. 3.2.2 Trình tự vùng giữa hai gen trnL-trnF của DNA lục lạp thông đỏ Mười một mẫu đại diện cho các quần thể khác nhau và các nhóm khác nhau (Bảng 3.2, phần kết quả và bàn luận) được chọn cho việc giải trình tự là: HT4 & HT5 đại diện cho quần thể Hồ Tiên; BD3 đại diện cho quần thể Bidoup; NT đại diện cho mẫu từ Vimedimex; NV2, NV13, NV14, NV21 & NV32 đại điện cho vùng Núi Voi; XT làm đại diện cho Xuân Trường và TQ là mẫu từ Hòa Bình. Việc giải trình tự được tiến hành ở Nam Khoa và Macrogen. -42- Kết quả & Bàn luận Các trình tự thu được từ các mồi trn-c, trn-d và trn-f của mỗi mẫu được lắp ráp lại bằng chương trình SeqMan trong bộ phần mềm Lasergene 7.0, sau đó đối chiếu kết quả lắp ráp với dữ liệu sắc đồ (chromatogram) để xác định các nucleotide chưa rõ. Khoảng 100 nucleotides ở hai đầu sẽ được loại bỏ do tính hiệu không rõ. 11 trình tự hoàn chỉnh sau đó sẽ được sắp giống cột bằng chương trình ClustalW2 ( để xác định những vùng tương đồng và vùng biến động giữa các trình tự khảo sát. Dựa trên sự sắp xếp các chuỗi nucleotide ở Hình 3.12, chương trình ClustalW2 và Treeview sẽ cho thấy mối tương quan vùng trình tự giữa 2 gen trnL-trnF trên cpDNA của các cá thể thông đỏ khảo sát. Để xác định mức độ tương đồng của vùng trình tự khảo sát với những trình tự có sẵn trong Genbank, 11 trình tự này sau đó được BLAST trên NCBI. NV13 CTAAGTGATA--CTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 58 XT CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 NV32 CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 HT4 CTAAGTGATATGCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 60 NV14 CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 NV21 CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 NV2 CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 NT CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 BD3 CTAAGAGTGATGCTTCCTA-TACAGGGGAACCCTGGAATATTTTGAATGGGCTATCCTGA 59 HT5 CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 TQ CTAAGTGATA-GCTTCCAAATACAGGGGAACCCTGGAATATTTTGAATGGGCAATCCTGA 59 ***** * * ***** * ******************************** ******* NV13 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 118 XT TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 NV32 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 HT4 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 120 NV14 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 NV21 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 NV2 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 NT TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 BD3 TCCAA-TCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 118 HT5 TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 TQ TCCAAATCCGTATTATAGGAACAATAATTTTATTTTCTAGAAAAGGGATAGGTGCAGAGA 119 ***** ****************************************************** NV13 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 238 XT CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 NV32 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 HT4 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 240 NV14 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 NV21 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 NV2 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 NT CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 BD3 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCTTCGTTAAAACTTGTT 238 HT5 CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 TQ CAGAGTGTAGTATGTTATTGAAAACTTTGAAAGTGTTCTGTATCATCGTTAAAACTTGTT 239 ******************************************** *************** -43- Kết quả & Bàn luận NV13 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 298 XT TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 NV32 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 HT4 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 300 NV14 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 NV21 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 NV2 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 NT TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 BD3 TCAACGATCAGAACTTGAGTTGGTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 298 HT5 TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 TQ TCAACGATTAGAACTTGAGTTGTTCTAGGCTTGCCTAGCTTAATGAATACTTAATTAAAG 299 ******** ************* ************************************* NV13 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 358 XT TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 NV32 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 HT4 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 360 NV14 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 NV21 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 NV2 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 NT TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 BD3 TTATTCATTTAAGAAATAAATAGAATTTATTCCATTTTTGAACTATTGGACGAGGATAAA 358 HT5 TAATTCAATTAAGAAATAAATAGAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 TQ TAATTAAATTAAGAAATAAATATAATTTATTCCATTTTTGAATTATTGGACGAGGATAAA 359 * *** * ************** ******************* ***************** NV13 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 478 XT AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 NV32 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 HT4 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 480 NV14 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 NV21 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 NV2 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTTTTTCA 479 NT AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 BD3 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTTC 478 HT5 AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 TQ AAATCCGTTGGTTTTATAAACCGTGAGGGTTCAAGTCCCTCTATCCCCAGGTGTATTTCC 479 ****************************************************** *** NV13 GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTATAAGCAATCC-AGAATAT 537 XT GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTATAAGCAATCCCAGAATAT 539 NV32 GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTATAAGCAATCC-AGAATAT 538 HT4 GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTATAAGCAATCC-AGAATAT 539 NV14 GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTATAAGCAATCC-AGAATAT 538 NV21 GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTATAAGCAATCC-AGAATAT 538 NV2 GAATTAAAGAAAGATCAAATATTATTACTCTTGACAATTTTAT

Các file đính kèm theo tài liệu này:

  • pdf7.pdf
  • pdf0.pdf
  • pdf1.pdf
  • pdf2.pdf
  • pdf3.pdf
  • pdf4.pdf
  • pdf5.pdf
  • pdf6.pdf
  • pdf8.pdf
  • pdf9.pdf
  • pdf10.pdf
Luận văn liên quan