Research on species, distribution and intoxicant of amanitaceae r.heim ex pouzar in highland

Fungi were a saprophyte in the ecological enviroment. They could extract enzyme to the enviroment to resolute complex molecules into simple substances. Thus they play the important role into improve the natural cycle of material circulation, mineralization of organic compounds, freshing the ecological environment, increasing the fertility of the soil, so increase crops and forest trees productivity. The ecosystem in the Central Highlands is diverse with six main ecosystem types, including tropical evergreen closed forest, deciduous subtropical wet forest, deciduous semi-evergreen tropical forest, coniferous mixed bamboo forest, grass and shrub, residential areas. Flora and founain this area is very abundant, has many rare and precious species in Red Data Book of Vietnam. Nature condition in Central Highlands is convenient to development of Fungi and Amanita genus. The research on large fungi is very little, concentrated on midland area. In the Central highlands, there are some research in South of Central highlands, the other areas almost has not researched. Amanitaceae play the important role in the Fungi as a diversities and special in poison, theses Fungi are highly toxic and easily confused with some edible fungus. The habit of using mushrooms in the wild and from the forest as food is quite common to the people in the locality. This areas was difficulties economic areas, living standard of the people is very low, most of them are poor and dependent forest. Thus forest is a sources to provide a food for living, among them mushroom is a the food that people say is a specialty. Wild mushrooms was delicious and aromatic with very high nutrients food. But it is also unfortunate confusion between the poisonous mushrooms and edible mushrooms.

pdf27 trang | Chia sẻ: thientruc20 | Lượt xem: 372 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Research on species, distribution and intoxicant of amanitaceae r.heim ex pouzar in highland, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
MINISTRY OF EDUCATION AND TRAINING VIETNAM ACADEMY OF SCIENCE AND TECHNOLOGY GRADUATE UNIVERSITY SCIENCE AND TECHNOLOGY ---------------------------- Name Ph.D Tran Thi Thu Hien RESEARCH ON SPECIES, DISTRIBUTION AND INTOXICANT OF AMANITACEAE R.HEIM EX POUZAR IN HIGHLAND MAJOR: Botany Code: 9 42 01 11 SUMMARY OF BIOLOGICALDOCTORAL THESIS HA NOI - 2018 This thesis was fulfilled at Graduate University of Science and Technology, VietNam Scientific instructor 1: Assoc. Prof. Dr. Tran Huy Thai Scientific instructor 2: Assoc. Prof. Dr. Le Ba Dung Reviewer 1: Prof. Dr. Pham Quang Thu Reviewer 2: Assoc. Prof. Dr. Tran The Bach Reviewer 3: Ph.D. Ha Minh Tam The thesis will be defended in the Graduate University of Science and Technology (GUST) council at Vietnam Academy of Science and Technology (VAST) at on.. 2018 This thesis may be found at: - The library of GUST - National Library of Vietnam 1 INTRODUCTION 1. Significance of the research Fungi were a saprophyte in the ecological enviroment. They could extract enzyme to the enviroment to resolute complex molecules into simple substances. Thus they play the important role into improve the natural cycle of material circulation, mineralization of organic compounds, freshing the ecological environment, increasing the fertility of the soil, so increase crops and forest trees productivity. The ecosystem in the Central Highlands is diverse with six main ecosystem types, including tropical evergreen closed forest, deciduous subtropical wet forest, deciduous semi-evergreen tropical forest, coniferous mixed bamboo forest, grass and shrub, residential areas. Flora and founain this area is very abundant, has many rare and precious species in Red Data Book of Vietnam. Nature condition in Central Highlands is convenient to development of Fungi and Amanita genus. The research on large fungi is very little, concentrated on midland area. In the Central highlands, there are some research in South of Central highlands, the other areas almost has not researched. Amanitaceae play the important role in the Fungi as a diversities and special in poison, theses Fungi are highly toxic and easily confused with some edible fungus. The habit of using mushrooms in the wild and from the forest as food is quite common to the people in the locality. This areas was difficulties economic areas, living standard of the people is very low, most of them are poor and dependent forest. Thus forest is a sources to provide a food for living, among them mushroom is a the food that people say is a specialty. Wild mushrooms was delicious and aromatic with very high nutrients food. But it is also unfortunate confusion between the poisonous mushrooms and edible mushrooms. 2 In the nature, there are alot of poisonous mushroom belong too other genus susch: Amanita, Galerina, Lepiota, inobybe, Agaricus eg: The genus Amanita have Amanita verna, Amanita virosa, Amanita phalloides should be a confusion for people when using wild mushrooms as food, in fact, there have been many cases of lethal fungal poisoning due to lack of knowledge about poisonous mushrooms. Inoder to provide the knowledge to the people who understand and distinguish between the poisonous mushrooms and edible mushrooms is very necessary. Thus, I have chosen the topic “Research on species, distribution and intoxicant of Amanitaceae R.Heim ex Pouzar in Highland”. 2. Research Objectives - Identify some biological, ecological characterisitics of Amanitaceae in Highland. - Analyze intoxicant of some species in Amanita genus. 3. Scientific significance of the research - Research on biological, ecological characterisitics Amanita genus. - Supplement large mushroom list particulary in Highland and Vietnam in general, simultaneously provide data basic for the other research fields. 4. Practical significance of the research Identify the poisonous mushrooms in the nature to prevent fungal poisoning. 5. New result of the research It is the first time to have a research on Amanitaceae, establish the list of species of Amanitaceae in Highland. Identify the scienctific name of 23 species among 33 species and uses molecular biology to identify 16 species of this family in the Central Highlands. Introduce 15 species as a new record for large fungi list of Vietnam and 8 species could be a new species. 3 Research on biological, ecological characterisitics Amanita genus - Establish the multivariate regression equation to focast the distribution of Amanita species was Tansoxuathien = C + a*l + b*m + c*h - d*t - Determined the intoxicant of Amanita sp.1 to causing death of experiment animal by oral with LD50 was 4750 mg/kg weight. 6. Chapter layout of thesis This thesis is including 159 pages, 12 tables, 37 figures, 1 map and index. The sections of the thesis were: Index, list of tables, list of figures, list of abbreviations, list of charts. Introduction (5 pages); Chapter 1: Overview of publications (30 pages); Chapter 2: Subject, location, content and research methods (23 pages); Chapter 3: Research results (90 pages); Conclustion and recommend (2 pages); List of published by the author related to the thesis (2 pages); Refefences (8 pages); Index. CHAPTER 1. OVERVIEW OF PUBLICATIONS 1.1. Fungi classification system 1.1.1. History of Fungi taxonomy 1.1.2. Basidiomycete and taxonomy system 1.1.3. Trinh Tam Kiet system Div. Basidiomycota R. T. Moore (1980) Fam. Amanitaceae R.Heinn ex Puozar (1983): 3 genus (+23 syns) Characteristic: Fruit body is fleshy, easy to putrid. Cap is umbrella shape, stalk central attached, easy to separate. Spore radiation produce in the gill. Gill free. Spores glabrescent, no colour in the microscope, pink when concentrated. Young fruit body has cover by two membrance, scar when adult. * Gen. Amanita Pers. (1987): Large distriobution, many species 4 were rooting mushrooms, some saprophyte. Characteristic of Amanita genus: - Many colours like: red, orange, yellow... - Cap fleshy, umbrella shape - Gill large, white or yellow... - Stalk fleshy, central attached, easy separate. - Spore no colour, globose to elippsoidal, glabrescen. - Saprophyte on land. - When the fruit body is immature, young body volva and skirt connect from cap margin to stalk. Then tear to ring and volva – these are particular characteristic of Amanita genus. * Gen Limacella Murrill (1911): including 3 species * Gen. Catatrama Franco-Mol. 1991: inculuding 02 species According to Trinh Tam Kiet, Le Ba Dung, Ngo Anh, Le Van Lieu there are 37 species (among them 33 species was identified and 04 species was not identified) in Amanitaceae family, 12 species has been described. 1.1.4. Fungal poisoning from Amanitaceae situation Mycetism was a toxic effects from eating the intoxicant in the mushroom. The symptoms are from disorders digestive to death. The toxins contained are secondary metabolites produced by the distinct biochemical in the fungi cell. Mushroom poisoning was a result by eating wild mushroom which not exactly identify. Mushroom poisoning sometimes happened with experience mushroom picker. Vietnam was a country which had abundant biodiversity in the wold. Recently, there are 3000 fungi species had been recorded in Vietnam in which 1800 species lare fungi, among them there are 50 species has intoxicant. Most of the poision mushroom was not lethal poision mushroom, but the lethal poision mushroom almost was Amanitaceae such as Amanita phalloides, Amanita virosa, Amanita verna. Amanita species are confusing to 5 other mushroom species, specially when young, boddy ovoid has volve is similar to Volvariella esculenta, Volvariella bombycina or other species Bovista, Lycoperdon. CHAPTER 2 SUBJECT, LOCATION, CONTENT AND RESEARCH METHODS 2.1. Subject, location, content and research methods 2.1.1. Subject Amanitaceae species has distribution in the Highland. 2.1.2. Material - Olympus microscope (Japan), Olympus magnifying glass (Japan), colour table, KOH liquid - Tools: + In the field: Chisel, knives, plastic bags, cameras + On tha laboratory: the pick, razor, lamen, + Needle, eppendof, aseptic water, analysis scale and other chemistries, some of molecular chemistries of Sigma, Merck,...CTAB, Tris base, acid Boric , NaCl, dNTPs, EDTA, 6X orange loading dye solution, Taq Polymeraza, Ethanol, 2-propanol, Acetic acid glacial, Phenol, Chloroform, isoamyalcohol, Agarose and ITS primer. Animal: BALB/c thoroughbred mouse was healthy in animal shelter of Institute of Biotechnology, Vietnam Academy of Science and Technology. Mouse has feed by standard food and free water. ITS primer list (White et al. 1989) No Mồi Nucleotide sequence ITS1 TCCGTAGGTGAACCTGCGG ITS4 TCCTCCGCTTATTGATATGC 6 2.1.3. Location Highland area (Chu Yang Sin National park, Yok Don National park, Ea Sô Nature conserve, Bidoup Núi Bà National Park, Chư Mom Ray National park, Kon Ka Kinh National park). 2.2. Contents - Investigate and collect the specimen of Amanataceae in the Highland. - Analyse biological, ecological characteristic of Amanitaceae collected species in Highland. - Identify the species of specimen was collectd and establish the List of Amanataceae species in Highland. - Analyse intoxic of one species of Amanataceae family. 2.3. Research Methodology 2.3.1. Collecting method for fungi in the Field work - Collect Amanataceae specimen by line survey that go through the different representations (broadleaved forest, coniferous forest, mixed forest...) in Highland. - The time to collect specimen: in rainy season (from June to November) The specimen was collected base on main characteristic of Amanitaceae family. 2.3.2. Processing and preservation specimen method Specimen was preserve in air and cool place. Change the cover when wet or dirty. Describe the characteristic of species on the field book such: size, colour, cap surface, merge characteristic, spore, stalk, gill, .the species was not identified or have enough standard sould be soaked. 7 2.3.3. Specimen analyze method 2.3.3.1. Morphology 2.3.3.2. Microscopic characteristics 2.3.4. Identify 2.3.4.1 Comparative morphologic method Base on document of Trinh Tam Kiet (2012,2013), Le Ba Dung (2003), Teng (1964), Singer R.(1986), Jiri Baier (1991), Denis R. Benjamin (1995) 2.3.4.2. Moleculare identifying method Some of the species had similar characteristic, thus we use moleculare indentifying method to analyze the distent between them. 2.3.5. Toxicity test method Toxicity test method is to Confirm the toxicity at different doses of the test substance when tested on animals. Animalswas divided to other goups, in which group animals has one dose, and increase the dose from one group to another. Note the death animals in the group, the dose and number of death animals in the group is an important parameter in Toxicity test method DoTrung Dam, Dodehe Yeo et al. (2012), N’dia Kouadio Frédéri et al. (2013), Aristide Traore et al. (2014). 2.3.6. Determined ecological factors method Determined ecological factors method (temperature, humidity, light, altitude) by using Tiger Direct HMAMT-110 (USA), TigerDirect LMLX1010B (USA), GPS Garmine Trex Vista HCx (USA). 2.3.7. Analyze the interrelation of ecological factors method MS TAT 2009 and Excel software used for statistical processing. Statgraphic Centurion XV software to to establish multivariate regression and to analyze the relationship of density, frequency of occurrence of species Mushrooms with ecological factors 8 CHAPTER 3 RESULT AND DISCCUSION 3.1. Amanitaceae R.Heinn ex Puzar (1983) morphology Fam. Amanitaceae R.Heinn ex Puozar (1983): 2 genera. Fruit body fleshy, easy to putrid. Cap is umbrella shape, stalk central attached, easy to separate. Spore radiation produce in the gill. Gill free ,Spores glabrescent, no colour in the microscope, pink when concentrated. Young fruit body has cover by two membrances, scar when adult. Gen. Amanita Dill. ex Boehm. 1760 Including the most poision mushroom distribution in hold the world. Characteristic: - Many colour like: red, orange, yellow... - Cap fleshy, umbrella shape - Gill large, white or yellow... - Stalk fleshy, central attached, easy separate. - Spore no colour, globose to elippsoidal, glabrescen. - Spore from 5-7 x 10-12 µm - Saprophyte on land. - Hole 20 - 30 0 - Young body Volva and skirt connect from cap margin to stalk. Then tear to ring and volva – these are particular characteristic of Amanita genus. Gen. Limacella Murrill 1911: 03 species rarely distribute in Asia. Gen. Catatrama Franco-Mol. 1991: there are 02 species in the world. 3.2. Amanitaceae species list in Highland This thesis was investigated, described, identified and established 25 species of Amanita, Amanitaceae (table 3.1). 9 Table 3.1: Amanitaceae species list in Highland No Science name Habitat Note R T R T X R B T X RHG LK&L R TC, CB 1 Amanita caesarea Gillet 1874 ++ + + ++ 2 Amanita caesareoides Lj.N. Vassiljeva 1950 + ++ +++ new record 3 Amanita crocea Quél. Singer 1951 ++ + + ++ new record 4 Amanita eliae Quél. 1872 ++ + 5 Amanita excelsa Fr. Bertill. 1866 ++ + ++ 6 Amanita flavoconia G.F. Atk. 1902 ++ ++ new record 7 Amanita fulva Fr. 1815 ++ + + ++ 8 Amanita multisquamosa Peck 1901 ++ + new record 9 Amanita pantherina D.T. Jenkins 1977 ++ + + ++ 10 Amanita phalloides (Fr.) Secr. 1833 + + + + 11 Amanita pilosella Corner & Bas 1962 + ++ ++ new record 12 Amanita similis Boedijn 1951 ++ + ++ new record 13 Amanita spreta Peck& acc 1887 + ++ ++ 14 Amanita sp1. ++ + + + ++ 15 Amanita sp2. + + ++ 16 Amanita sp3. ++ + ++ 17 Amanita sp4. ++ + ++ + 18 Amanita sp5. + +++ ++ 19 Amanita sp6. + +++ + 20 Amanita sp7. (DL274) ++ + ++ + 21 Amanita sp8. (DL89) ++ + + 10 + 22 Amanita sp9. (DH048) ++ + + 23 Amanita sp10. (DL001) + + + 24 Amanita sp11. (DL127) ++ + + ++ 25 Amanita sp12. (DL019) + + +++ + (RT: Pinus forest; RTX: evergreen forest; RBTX: Semi-evergreen fores; RHGLK&LR: needles and broad leaves mixed; TC, CB: grass and brush) Note: +: Species scare ++: Species abudant +++: Species verry audant 11 Map of collection Amanitaceae speciemen in Central Highlands 3.3. Key to species of genus Amanita 1. Stalk complete, volva receptacle ...................................................... 2 1. Stalk complete, volva not receptacle ................................................ 3 2. Stalk collar shape ............................................................................ 11 2. Stalk not nectar shape ..................................................................... 12 3. Volva bulb shape, stalk ring .......................................................... 4 3. Volva bulb shape, stalk not ring .................................................... 5 4. Cap and stalk dark yellow to ferruginous, ring collar shape connect to 1/3 stalk above. Spore 5-7 x 8-10 µm .......... Amanita flavoconia. 4. Cap and stalk dirty white, minute scales in surface, ring connect 1/3 stalk basal. Spore 6-8 x 8-10 µ .......................... Amanita concentrica. (II) Yok Don NP: 12°45′ - 13°10′ N; 107°29′30″ - 107°48′30″ E (VI) Bidoup Núi Bà NP: 12°00'00" - 12°30'00" N; 108°35'00" - 108°75'00" E (III) Chu Yang Sin NP: 120°14′16″ - 130°30′58″ N; 108°17′47″ - 108°34′48″ E (I) Ea sô NC: 12 O53’18” - 13 O02’12” N; 108 O28’48” - 108 O43’54” E. (V) Chu Mon Ray NP (Kon Tum): 14°18′ - 14°38′ N, 107°29′ - 107°47′ E (IV) KonKa Kinh NP (Gia Lai): 14°09′ - 14°30′ N; 108°16′ - 108°28′ E 12 5. Stalk withou scales ........................................................................ 6 5. Stalk scales, cap verrucose smaller than 2 cm ......................................... 7 6. Cap verucose saller 2 cm ............................................................................... 8 6. Cap verucosecó larger than 2 cm .................................................................. 9 7. Cap light brown, spore smaller 9 μm, verucose sparse, concentrate in a central, spore oblong- ellipsoid, 5-6×7-9 μm, endorsperm yellow...Amanita excelsa. 7. Spore larger than 9 μm ................................................................... 10 8. Cap flat, slightly concave. Ring stalk distintc; Spore globose, 7-9 x 10-12 µm, endorsperm seed oil of floating ......... Amanita pilosella. 8. Cap tan colour, stalk cylindiric,light whight, fiber system crystal, baffled, ring stalk indistintc, spore 5-8 x 9-12 µmAmanita multisquamosa. 8. Cap dark brown, rings on the central of stalk, surface mucusly, spore 6-8 x 8-10 µm ............................................................. Amanita pantherina. 9. Cap convex, white, around the cap have folds, fiber system light yellow, wall, spore 6-8 x 9-12 µm, endorsperm green seedsAmanita hesleri. 9. Cap umbrella shape, white, scaly white; Stalk white, ring distinct. Fiber system crystal, whithout wall, spore 8 - 10m in diameter, endorsperm green without seeds ................................................... Amanita cokeri. 10. Verucose denserly on cap surface, spot many colour: from white to black, ring collar shape distinct, spore 6-9 x 8-11 µm, endorsperm seed oil of floating .................................................... Amanita sp.DL274. 10. Verucose denserly on cap surface, white; Stalk bulge in the middle, Spore 7-9 x 8-12 µm, endorsperm seed oil . Amanita abrupta. 10. Verucose sparse, spore thick, globose, 6-8 x 9-11 µm, endorsperm yellow to green seeds, Cap light grey-brownAmanita sp. DL89 11. Cap capanulate, light grey to brown-grey, stalk cylindric, ring white, scar shape. Spore 6-8 x 8-10 µm. Fiber system without wallAmanita Phalloides. 11. Cap smooth, orange yellow ..................................................... 14 11. Cap is not smooths ................................................................... 13 12. Fruit body conical .................................................................... 16 12. Fruit body capanulate .............................................................. 17 12. Fruit body umbrella shape ....................................................... 18 13. Cap umbrella shape, white verucose on cap surface, spore elipsoid starch granules, 4-6 x 8-10 µm. Pore with pink colour, ring closed to cap, fiber system without wall (4-6µm in diameter) ........Amanita Sp.1 13. Stype cream white ................................................................ 15 13 14. Cap umbrella shape, yellow on the top. Spore yellow, without endorsperm, 5-7 x 9-12 µm, fiber system without wall .Amanita cacsarea. 14. Cap umbrella shape, yellow on the top; stalk ligh yellow or scream white; Spore has yellow endorsperm, 5-7 x 8-10 µm; fiber system has wall ..................................................................... Amanita Levistriata 15. Cap umbrella shape, cream white, brown verucose on cap surface, central of cap brown yelow, ring ¼ from top of stalk, stype slabs free, gill not equal, closed, cream white; fiber system without wall, spore elipsoid, 6- 7 x 10-13 µm ..................................................... Amanita sp.2 15. Cap umbrella shape, dark