Fungi were a saprophyte in the ecological enviroment. They could
extract enzyme to the enviroment to resolute complex molecules into
simple substances. Thus they play the important role into improve the
natural cycle of material circulation, mineralization of organic compounds,
freshing the ecological environment, increasing the fertility of the soil, so
increase crops and forest trees productivity.
The ecosystem in the Central Highlands is diverse with six main
ecosystem types, including tropical evergreen closed forest, deciduous
subtropical wet forest, deciduous semi-evergreen tropical forest, coniferous
mixed bamboo forest, grass and shrub, residential areas. Flora and founain
this area is very abundant, has many rare and precious species in Red Data
Book of Vietnam.
Nature condition in Central Highlands is convenient to
development of Fungi and Amanita genus. The research on large fungi is
very little, concentrated on midland area. In the Central highlands, there are
some research in South of Central highlands, the other areas almost has not
researched. Amanitaceae play the important role in the Fungi as a
diversities and special in poison, theses Fungi are highly toxic and easily
confused with some edible fungus.
The habit of using mushrooms in the wild and from the forest as
food is quite common to the people in the locality. This areas was
difficulties economic areas, living standard of the people is very low, most
of them are poor and dependent forest. Thus forest is a sources to provide a
food for living, among them mushroom is a the food that people say is a
specialty. Wild mushrooms was delicious and aromatic with very high
nutrients food. But it is also unfortunate confusion between the poisonous
mushrooms and edible mushrooms.
27 trang |
Chia sẻ: thientruc20 | Lượt xem: 371 | Lượt tải: 0
Bạn đang xem trước 20 trang tài liệu Research on species, distribution and intoxicant of amanitaceae r.heim ex pouzar in highland, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
MINISTRY OF EDUCATION
AND TRAINING
VIETNAM ACADEMY
OF SCIENCE AND
TECHNOLOGY
GRADUATE UNIVERSITY SCIENCE AND TECHNOLOGY
----------------------------
Name Ph.D Tran Thi Thu Hien
RESEARCH ON SPECIES, DISTRIBUTION AND INTOXICANT
OF AMANITACEAE R.HEIM EX POUZAR IN HIGHLAND
MAJOR: Botany
Code: 9 42 01 11
SUMMARY OF BIOLOGICALDOCTORAL THESIS
HA NOI - 2018
This thesis was fulfilled at Graduate University of Science and
Technology, VietNam
Scientific instructor 1: Assoc. Prof. Dr. Tran Huy Thai
Scientific instructor 2: Assoc. Prof. Dr. Le Ba Dung
Reviewer 1: Prof. Dr. Pham Quang Thu
Reviewer 2: Assoc. Prof. Dr. Tran The Bach
Reviewer 3: Ph.D. Ha Minh Tam
The thesis will be defended in the Graduate University of Science and
Technology (GUST) council at Vietnam Academy of Science and
Technology (VAST) at on.. 2018
This thesis may be found at:
- The library of GUST
- National Library of Vietnam
1
INTRODUCTION
1. Significance of the research
Fungi were a saprophyte in the ecological enviroment. They could
extract enzyme to the enviroment to resolute complex molecules into
simple substances. Thus they play the important role into improve the
natural cycle of material circulation, mineralization of organic compounds,
freshing the ecological environment, increasing the fertility of the soil, so
increase crops and forest trees productivity.
The ecosystem in the Central Highlands is diverse with six main
ecosystem types, including tropical evergreen closed forest, deciduous
subtropical wet forest, deciduous semi-evergreen tropical forest, coniferous
mixed bamboo forest, grass and shrub, residential areas. Flora and founain
this area is very abundant, has many rare and precious species in Red Data
Book of Vietnam.
Nature condition in Central Highlands is convenient to
development of Fungi and Amanita genus. The research on large fungi is
very little, concentrated on midland area. In the Central highlands, there are
some research in South of Central highlands, the other areas almost has not
researched. Amanitaceae play the important role in the Fungi as a
diversities and special in poison, theses Fungi are highly toxic and easily
confused with some edible fungus.
The habit of using mushrooms in the wild and from the forest as
food is quite common to the people in the locality. This areas was
difficulties economic areas, living standard of the people is very low, most
of them are poor and dependent forest. Thus forest is a sources to provide a
food for living, among them mushroom is a the food that people say is a
specialty. Wild mushrooms was delicious and aromatic with very high
nutrients food. But it is also unfortunate confusion between the poisonous
mushrooms and edible mushrooms.
2
In the nature, there are alot of poisonous mushroom belong too
other genus susch: Amanita, Galerina, Lepiota, inobybe, Agaricus eg:
The genus Amanita have Amanita verna, Amanita virosa, Amanita
phalloides should be a confusion for people when using wild mushrooms
as food, in fact, there have been many cases of lethal fungal poisoning due
to lack of knowledge about poisonous mushrooms.
Inoder to provide the knowledge to the people who understand and
distinguish between the poisonous mushrooms and edible mushrooms is
very necessary. Thus, I have chosen the topic
“Research on species, distribution and intoxicant of Amanitaceae
R.Heim ex Pouzar in Highland”.
2. Research Objectives
- Identify some biological, ecological characterisitics of
Amanitaceae in Highland.
- Analyze intoxicant of some species in Amanita genus.
3. Scientific significance of the research
- Research on biological, ecological characterisitics Amanita genus.
- Supplement large mushroom list particulary in Highland and
Vietnam in general, simultaneously provide data basic for the other research
fields.
4. Practical significance of the research
Identify the poisonous mushrooms in the nature to prevent fungal
poisoning.
5. New result of the research
It is the first time to have a research on Amanitaceae, establish the
list of species of Amanitaceae in Highland. Identify the scienctific name of
23 species among 33 species and uses molecular biology to identify 16
species of this family in the Central Highlands. Introduce 15 species as a
new record for large fungi list of Vietnam and 8 species could be a new
species.
3
Research on biological, ecological characterisitics Amanita genus
- Establish the multivariate regression equation to focast the
distribution of Amanita species was Tansoxuathien = C + a*l + b*m +
c*h - d*t
- Determined the intoxicant of Amanita sp.1 to causing death of
experiment animal by oral with LD50 was 4750 mg/kg weight.
6. Chapter layout of thesis
This thesis is including 159 pages, 12 tables, 37 figures, 1 map and
index.
The sections of the thesis were: Index, list of tables, list of figures,
list of abbreviations, list of charts.
Introduction (5 pages); Chapter 1: Overview of publications (30
pages); Chapter 2: Subject, location, content and research methods (23
pages); Chapter 3: Research results (90 pages); Conclustion and
recommend (2 pages); List of published by the author related to the thesis
(2 pages); Refefences (8 pages); Index.
CHAPTER 1. OVERVIEW OF PUBLICATIONS
1.1. Fungi classification system
1.1.1. History of Fungi taxonomy
1.1.2. Basidiomycete and taxonomy system
1.1.3. Trinh Tam Kiet system
Div. Basidiomycota R. T. Moore (1980)
Fam. Amanitaceae R.Heinn ex Puozar (1983): 3 genus (+23
syns)
Characteristic: Fruit body is fleshy, easy to putrid. Cap is
umbrella shape, stalk central attached, easy to separate. Spore
radiation produce in the gill. Gill free. Spores glabrescent, no colour
in the microscope, pink when concentrated. Young fruit body has cover
by two membrance, scar when adult.
* Gen. Amanita Pers. (1987): Large distriobution, many species
4
were rooting mushrooms, some saprophyte.
Characteristic of Amanita genus:
- Many colours like: red, orange, yellow...
- Cap fleshy, umbrella shape
- Gill large, white or yellow...
- Stalk fleshy, central attached, easy separate.
- Spore no colour, globose to elippsoidal, glabrescen.
- Saprophyte on land.
- When the fruit body is immature, young body volva and skirt
connect from cap margin to stalk. Then tear to ring and volva – these are
particular characteristic of Amanita genus.
* Gen Limacella Murrill (1911): including 3 species
* Gen. Catatrama Franco-Mol. 1991: inculuding 02 species
According to Trinh Tam Kiet, Le Ba Dung, Ngo Anh, Le Van
Lieu there are 37 species (among them 33 species was identified and
04 species was not identified) in Amanitaceae family, 12 species has
been described.
1.1.4. Fungal poisoning from Amanitaceae situation
Mycetism was a toxic effects from eating the intoxicant in the
mushroom. The symptoms are from disorders digestive to death. The
toxins contained are secondary metabolites produced by the distinct
biochemical in the fungi cell. Mushroom poisoning was a result by eating
wild mushroom which not exactly identify. Mushroom poisoning
sometimes happened with experience mushroom picker.
Vietnam was a country which had abundant biodiversity in the wold.
Recently, there are 3000 fungi species had been recorded in Vietnam in which
1800 species lare fungi, among them there are 50 species has intoxicant.
Most of the poision mushroom was not lethal poision mushroom, but
the lethal poision mushroom almost was Amanitaceae such as Amanita
phalloides, Amanita virosa, Amanita verna. Amanita species are confusing to
5
other mushroom species, specially when young, boddy ovoid has volve is
similar to Volvariella esculenta, Volvariella bombycina or other species
Bovista, Lycoperdon.
CHAPTER 2
SUBJECT, LOCATION, CONTENT AND RESEARCH METHODS
2.1. Subject, location, content and research methods
2.1.1. Subject
Amanitaceae species has distribution in the Highland.
2.1.2. Material
- Olympus microscope (Japan), Olympus magnifying glass (Japan),
colour table, KOH liquid
- Tools:
+ In the field: Chisel, knives, plastic bags, cameras
+ On tha laboratory: the pick, razor, lamen,
+ Needle, eppendof, aseptic water, analysis scale and other
chemistries, some of molecular chemistries of Sigma, Merck,...CTAB, Tris
base, acid Boric , NaCl, dNTPs, EDTA, 6X orange loading dye solution, Taq
Polymeraza, Ethanol, 2-propanol, Acetic acid glacial, Phenol, Chloroform,
isoamyalcohol, Agarose and ITS primer.
Animal: BALB/c thoroughbred mouse was healthy in animal shelter
of Institute of Biotechnology, Vietnam Academy of Science and
Technology. Mouse has feed by standard food and free water.
ITS primer list (White et al. 1989)
No
Mồi
Nucleotide sequence
ITS1
TCCGTAGGTGAACCTGCGG
ITS4 TCCTCCGCTTATTGATATGC
6
2.1.3. Location
Highland area (Chu Yang Sin National park, Yok Don National
park, Ea Sô Nature conserve, Bidoup Núi Bà National Park, Chư Mom Ray
National park, Kon Ka Kinh National park).
2.2. Contents
- Investigate and collect the specimen of Amanataceae in the
Highland.
- Analyse biological, ecological characteristic of Amanitaceae
collected species in Highland.
- Identify the species of specimen was collectd and establish the
List of Amanataceae species in Highland.
- Analyse intoxic of one species of Amanataceae family.
2.3. Research Methodology
2.3.1. Collecting method for fungi in the Field work
- Collect Amanataceae specimen by line survey that go through the
different representations (broadleaved forest, coniferous forest, mixed
forest...) in Highland.
- The time to collect specimen: in rainy season (from June to
November)
The specimen was collected base on main characteristic of
Amanitaceae family.
2.3.2. Processing and preservation specimen method
Specimen was preserve in air and cool place. Change the cover
when wet or dirty. Describe the characteristic of species on the field book
such: size, colour, cap surface, merge characteristic, spore, stalk, gill, .the
species was not identified or have enough standard sould be soaked.
7
2.3.3. Specimen analyze method
2.3.3.1. Morphology
2.3.3.2. Microscopic characteristics
2.3.4. Identify
2.3.4.1 Comparative morphologic method
Base on document of Trinh Tam Kiet (2012,2013), Le Ba Dung
(2003), Teng (1964), Singer R.(1986), Jiri Baier (1991), Denis R. Benjamin
(1995)
2.3.4.2. Moleculare identifying method
Some of the species had similar characteristic, thus we use
moleculare indentifying method to analyze the distent between them.
2.3.5. Toxicity test method
Toxicity test method is to Confirm the toxicity at different doses of
the test substance when tested on animals. Animalswas divided to other
goups, in which group animals has one dose, and increase the dose from
one group to another. Note the death animals in the group, the dose and
number of death animals in the group is an important parameter in Toxicity
test method DoTrung Dam, Dodehe Yeo et al. (2012), N’dia Kouadio
Frédéri et al. (2013), Aristide Traore et al. (2014).
2.3.6. Determined ecological factors method
Determined ecological factors method (temperature, humidity, light,
altitude) by using Tiger Direct HMAMT-110 (USA), TigerDirect
LMLX1010B (USA), GPS Garmine Trex Vista HCx (USA).
2.3.7. Analyze the interrelation of ecological factors method
MS TAT 2009 and Excel software used for statistical processing.
Statgraphic Centurion XV software to to establish multivariate
regression and to analyze the relationship of density, frequency of
occurrence of species Mushrooms with ecological factors
8
CHAPTER 3
RESULT AND DISCCUSION
3.1. Amanitaceae R.Heinn ex Puzar (1983) morphology
Fam. Amanitaceae R.Heinn ex Puozar (1983): 2 genera.
Fruit body fleshy, easy to putrid. Cap is umbrella shape, stalk
central attached, easy to separate. Spore radiation produce in the gill.
Gill free ,Spores glabrescent, no colour in the microscope, pink when
concentrated. Young fruit body has cover by two membrances, scar
when adult.
Gen. Amanita Dill. ex Boehm. 1760
Including the most poision mushroom distribution in hold the world.
Characteristic:
- Many colour like: red, orange, yellow...
- Cap fleshy, umbrella shape
- Gill large, white or yellow...
- Stalk fleshy, central attached, easy separate.
- Spore no colour, globose to elippsoidal, glabrescen.
- Spore from 5-7 x 10-12 µm
- Saprophyte on land.
- Hole 20 - 30
0
- Young body Volva and skirt connect from cap margin to stalk.
Then tear to ring and volva – these are particular characteristic of Amanita
genus.
Gen. Limacella Murrill 1911: 03 species rarely distribute in Asia.
Gen. Catatrama Franco-Mol. 1991: there are 02 species in the
world.
3.2. Amanitaceae species list in Highland
This thesis was investigated, described, identified and established
25 species of Amanita, Amanitaceae (table 3.1).
9
Table 3.1: Amanitaceae species list in Highland
No
Science name
Habitat
Note R
T
R
T
X
R
B
T
X
RHG
LK&L
R
TC,
CB
1
Amanita caesarea
Gillet 1874
++
+
+ ++
2
Amanita caesareoides
Lj.N. Vassiljeva 1950
+ ++ +++ new record
3
Amanita crocea Quél.
Singer 1951
++
+
+ ++ new record
4
Amanita eliae Quél.
1872
++ +
5
Amanita excelsa Fr.
Bertill. 1866
++
+
++
6
Amanita flavoconia
G.F. Atk. 1902
++ ++ new record
7 Amanita fulva Fr. 1815
++
+
+ ++
8
Amanita
multisquamosa Peck
1901
++
+
new record
9
Amanita pantherina
D.T. Jenkins 1977
++
+
+ ++
10
Amanita phalloides
(Fr.) Secr. 1833
+ + + +
11
Amanita pilosella
Corner & Bas 1962
+ ++ ++ new record
12
Amanita similis
Boedijn 1951
++
+
++ new record
13
Amanita spreta Peck&
acc 1887
+ ++ ++
14 Amanita sp1.
++
+
+ + ++
15 Amanita sp2. + + ++
16 Amanita sp3.
++
+
++
17 Amanita sp4.
++
+
++ +
18 Amanita sp5. + +++ ++
19 Amanita sp6. + +++ +
20 Amanita sp7. (DL274)
++
+
++ +
21 Amanita sp8. (DL89) ++ + +
10
+
22 Amanita sp9. (DH048)
++
+
+
23
Amanita sp10.
(DL001)
+ + +
24
Amanita sp11.
(DL127)
++
+
+ ++
25
Amanita sp12.
(DL019)
+ + +++ +
(RT: Pinus forest; RTX: evergreen forest; RBTX: Semi-evergreen fores;
RHGLK&LR: needles and broad leaves mixed; TC, CB: grass and brush)
Note:
+: Species scare
++: Species abudant
+++: Species verry audant
11
Map of collection Amanitaceae speciemen in Central Highlands
3.3. Key to species of genus Amanita
1. Stalk complete, volva receptacle ...................................................... 2
1. Stalk complete, volva not receptacle ................................................ 3
2. Stalk collar shape ............................................................................ 11
2. Stalk not nectar shape ..................................................................... 12
3. Volva bulb shape, stalk ring .......................................................... 4
3. Volva bulb shape, stalk not ring .................................................... 5
4. Cap and stalk dark yellow to ferruginous, ring collar shape connect to 1/3
stalk above. Spore 5-7 x 8-10 µm .......... Amanita flavoconia.
4. Cap and stalk dirty white, minute scales in surface, ring connect 1/3 stalk
basal. Spore 6-8 x 8-10 µ .......................... Amanita concentrica.
(II)
Yok Don NP:
12°45′ - 13°10′
N; 107°29′30″ -
107°48′30″ E
(VI)
Bidoup Núi Bà
NP: 12°00'00" -
12°30'00" N;
108°35'00" -
108°75'00" E
(III)
Chu Yang Sin
NP:
120°14′16″ -
130°30′58″ N;
108°17′47″ -
108°34′48″ E
(I)
Ea sô NC:
12
O53’18” -
13
O02’12” N;
108
O28’48” -
108
O43’54” E.
(V)
Chu Mon Ray
NP (Kon Tum):
14°18′ - 14°38′
N, 107°29′ -
107°47′ E
(IV)
KonKa Kinh NP
(Gia
Lai): 14°09′ -
14°30′ N;
108°16′ -
108°28′ E
12
5. Stalk withou scales ........................................................................ 6
5. Stalk scales, cap verrucose smaller than 2 cm ......................................... 7
6. Cap verucose saller 2 cm ............................................................................... 8
6. Cap verucosecó larger than 2 cm .................................................................. 9
7. Cap light brown, spore smaller 9 μm, verucose sparse, concentrate in a
central, spore oblong- ellipsoid, 5-6×7-9 μm, endorsperm yellow...Amanita
excelsa.
7. Spore larger than 9 μm ................................................................... 10
8. Cap flat, slightly concave. Ring stalk distintc; Spore globose, 7-9 x 10-12
µm, endorsperm seed oil of floating ......... Amanita pilosella.
8. Cap tan colour, stalk cylindiric,light whight, fiber system crystal, baffled,
ring stalk indistintc, spore 5-8 x 9-12 µmAmanita multisquamosa.
8. Cap dark brown, rings on the central of stalk, surface mucusly, spore 6-8
x 8-10 µm ............................................................. Amanita pantherina.
9. Cap convex, white, around the cap have folds, fiber system light yellow, wall,
spore 6-8 x 9-12 µm, endorsperm green seedsAmanita hesleri.
9. Cap umbrella shape, white, scaly white; Stalk white, ring distinct. Fiber
system crystal, whithout wall, spore 8 - 10m in diameter, endorsperm green
without seeds ................................................... Amanita cokeri.
10. Verucose denserly on cap surface, spot many colour: from white to
black, ring collar shape distinct, spore 6-9 x 8-11 µm, endorsperm seed oil
of floating .................................................... Amanita sp.DL274.
10. Verucose denserly on cap surface, white; Stalk bulge in the middle,
Spore 7-9 x 8-12 µm, endorsperm seed oil . Amanita abrupta.
10. Verucose sparse, spore thick, globose, 6-8 x 9-11 µm, endorsperm
yellow to green seeds, Cap light grey-brownAmanita sp. DL89
11. Cap capanulate, light grey to brown-grey, stalk cylindric, ring white,
scar shape. Spore 6-8 x 8-10 µm. Fiber system without wallAmanita
Phalloides.
11. Cap smooth, orange yellow ..................................................... 14
11. Cap is not smooths ................................................................... 13
12. Fruit body conical .................................................................... 16
12. Fruit body capanulate .............................................................. 17
12. Fruit body umbrella shape ....................................................... 18
13. Cap umbrella shape, white verucose on cap surface, spore elipsoid
starch granules, 4-6 x 8-10 µm. Pore with pink colour, ring closed to cap,
fiber system without wall (4-6µm in diameter) ........Amanita Sp.1
13. Stype cream white ................................................................ 15
13
14. Cap umbrella shape, yellow on the top. Spore yellow, without
endorsperm, 5-7 x 9-12 µm, fiber system without wall .Amanita cacsarea.
14. Cap umbrella shape, yellow on the top; stalk ligh yellow or scream
white; Spore has yellow endorsperm, 5-7 x 8-10 µm; fiber system has wall
..................................................................... Amanita Levistriata
15. Cap umbrella shape, cream white, brown verucose on cap surface,
central of cap brown yelow, ring ¼ from top of stalk, stype slabs free, gill
not equal, closed, cream white; fiber system without wall, spore elipsoid, 6-
7 x 10-13 µm ..................................................... Amanita sp.2
15. Cap umbrella shape, dark