Tóm tắt Luận án Determination of causative bacteria agent of hemorrhagic disease in mudskipper

Mudskipper (Pseudapocryptes elongatus) is a special species of high economic value, are consumed widely in domestic and export value. Mudskipper cultures in the provinces Mekong Delta region, however, in the recent times mudskipper were sick with pathological signs of hemorrhage in the body, at the fin and anal with a high mortality rate and widespread. Most of determination of hemorrhagic disease are bacteria. Streptococcus agalactiae is typical as the causative agent of tilapia (Oreochromis sp.) (Pham Hong Quan et al., 2013), red tilapia (Oreochromis sp.) (Dang Thi Hoang Oanh and Nguyen Thanh Phuong, 2012). S. iniae on seabass (Latex calcarifer) (Tran Vi hich and Nguyen Huu Dung, 2011),

pdf27 trang | Chia sẻ: lecuong1825 | Lượt xem: 1850 | Lượt tải: 0Freedownload
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Determination of causative bacteria agent of hemorrhagic disease in mudskipper, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY NGUYEN THU DUNG DETERMINATION OF CAUSATIVE BACTERIA AGENT OF HEMORRHAGIC DISEASE IN MUDSKIPPER (Pseudapocryptes elongatus) Major in Aquaculture Identification code: 62620301 SUMMARY OF DOCTORAL DISSERTATION IN AQUACULTURE 2015 This study was achieved at the College of Aquaculture and Fisheries, Can Tho University. Scientific advisors: Assoc Prof. Dr. ĐANG THI HOANG OANH Reviewer 1:... Reviewer 2:... Reviewer 3:... This dissertation was defended at the University Examination Committee At... At hour.., on datemonth..year The dissertation is available at: 1. Center for education materials of Can Tho University 2. National library MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY NGUYEN THU DUNG DETERMINATION OF CAUSATIVE BACTERIA AGENT OF HEMORRHAGIC DISEASE IN MUDSKIPPER (Pseudapocryptes elongatus) Major in Aquaculture Identification code: 62620301 SUMMARY OF DOCTORAL DISSERTATION IN AQUACULTURE Scientific advisors: Assoc Prof. Dr. ĐANG THI HOANG OANH 2015 1 Chapter 1. OVERVIEW OF THE DISSERTATION 1.1 Introduction Mudskipper (Pseudapocryptes elongatus) is a special species of high economic value, are consumed widely in domestic and export value. Mudskipper cultures in the provinces Mekong Delta region, however, in the recent times mudskipper were sick with pathological signs of hemorrhage in the body, at the fin and anal with a high mortality rate and widespread. Most of determination of hemorrhagic disease are bacteria. Streptococcus agalactiae is typical as the causative agent of tilapia (Oreochromis sp.) (Pham Hong Quan et al., 2013), red tilapia (Oreochromis sp.) (Dang Thi Hoang Oanh and Nguyen Thanh Phuong, 2012). S. iniae on seabass (Latex calcarifer) (Tran Vi hich and Nguyen Huu Dung, 2011), Japanese flounder (Paralichthys olivaceus), red croaker (Sciaenops ocellates) (Eldar et al., 1999). In addition, fish diseases are caused by S. dysgalactiae in mullet (Liza alata, Liza haemotocheila) (Qi et al., 2013), sturgeon (Acipencer schrenckii) (Yang and Li, 2009), fish brown (Mugil cephalus) and cobia (Rachycentron canadum) (Abdelsalam et al., 2009). Determination of hemorrhagic disease also is found from many different species as Aeromonas hydrophila bacteria (Loan et al., 2009), Vibrio parahaemolyticus and V. alginolyticus on grouper (juvenile and grow up) (Somkiat Kanchanakhan, 1996; Nguyen Thi Thanh Thuy et al., 2009 was quoted by Vo Van Nha, 2012). Because of various agents causative diseases, so the prevention and treatment of dengue in aquatic animals are only effective when the agent and the cause is pinpointed. Currently, determination of hemorrhagic disease on mudskipper isn’t researching, to provide information for disease prevention and treatment hemorrhagic on mudskipper "Determination of causative bacteria agent of hemorrhagic disease in mudskipper (Pseudapocryptes elongatus) " is researched. 1.2 General objective of the study Survey and assessment of hemorrhage appear on a mudskipper farm in Bac Lieu province. Identifying characteristics of Pathology in fish pathogens which proposed solutions to prevent and treat the disease effectively. 1.3 Scientific significance and applicable ability of the dissertation Information from the results of an mudskipper condition and prevent disease process will contribute to limit the damage in the farming process 2 mudskipper effective on economic productivity and income generation for farmers. 1.4 New findings of the dissertation Identifying the causative agent of hemorrhagic disease in mudskipper is S. dysagalactiae and the time the disease usually appear in mudskipper ponds. A polymerase chain reaction (PCR) was preformed and optimized for detection of S. dysgalactiae bacteria to apply early diagnosis, rapid and specific the causative agent of hemorrhagic disease in mudskipper. Recommend some antibiotic treatment of hemorrhagic disease in mudskipper. Chapter 2. LITERATURE REVIEW In the literature review, the thesis described and analyzed the issues related to the situation of indentured mudskipper as well as the study of certain types of pathogenic bacteria on the fish to the main contents: - The situation of indentured mudskipper in the world and country. - The situation of the disease appears on mudskipper. - Overview of hemorrhagic disease in fish. - Overview of the characteristics of the bacteria on the fish. - Overview of the situation pathogens Streptococcus on brackish and sea fish. - Determination of the virulence of some strains of the bacteria that cause hemorrhagic disease. - Diagnosis of hemorrhage. - Prevention and treatment of dengue in fish. Chapter 3. METHODS OF THE STUDY 3.1 3.1 Study periods and site Time to research: from September, 2011 to December, 2014 3.2 Study species: Mudskipper 3.3 Study methods 3.3.1 The interview 3.3.1.1 The secondary data Collected from the report of specialized agencies in Bac Lieu province. Secondary data include aquaculture situation and the situation of mudskipper farm in Bac Lieu. 3.3.1.2 The primary data Interview 90 farmers mudskipper commercial in Bac Lieu town, Hoa Binh District and Dong Hai District, Bac Lieu province. Primary data 3 include basic information, experience, culture techniques, information on fish diseases and how to treat the disease when mudskipper disease. 3.3.2 Fish sampling methods - Fish sample: mudskipper live, sample of 254 fish living in 34 pounds (11 ponds normal, 23 ponds have a mudskipper hemorrhagic disease). - Conditions for sampling: fish are 2-3 months old, weight 15-25 g/fish. Sampling time is 7-8 am. 3.3.3 Testing Method parasites The number of test samples of parasitic is 120 samples in 12 ponds, include 04 sampling sessions, each of 03 ponds, each pond 10 fish. Check the skin, gills and gut a fish. The level of parasite infection: The rate of infection = (The number of infection samples/Total samples tested) x 100 The intensity of infection = (The number of parasite/Fish, organ, lame, microscope) 3.3.4 The method of sample analysis bacteria 3.3.4.1 Giemsa staining method To spread kidney samples up lame. Samples were fixed in methanol for 1 minute. Giemsa staining method according Humason, 1979 cited by Rowley, 1990. Read the results by a microscope at 100X with oil drop. 3.3.4.2 The method of isolation and identification of bacteria - Use a sterile scalpel incision in the kidney. Through kidney by implanting, twist to take samples and cultured on agar plate. Incubate plates in an incubator at a temperature of 28°C. After 24-48 hours, read the results. - Check the net of bacteria, oxidase, catalase, O/F, capability development of bacteria in the environment TSB (+ 6.5% NaCl), the hemolytic ability of bacteria. d. The method of identification of bacteria by API 20 Strep kit (Biomérieux, Pháp) Random identifier 32 strains of bacteria collected is obtained sampling 06 times by API 20 Strep kit. 3.3.5 The identification of bacteria by sequencing method 3.3.5.1 The method of bacterial DNA extraction The process of DNA extraction from bacteria applied by the method of Bartie et al. (2006). Bacteria proliferate raised from 16-18 hours in 5 ml of NB (+ 1.5% NaCl) at a temperature of 28ºC, DNA extraction by 1.5 ml 4 of bacteria to the centrifuge tube with 100 mM Tris-HCL l 10, 1 mM EDTA, pH 8.0 (TE). The mixture was heated at 95ºC for 15 minutes, then cooled in ice and centrifuged for 2 minutes at the speed of 14,000 circle/min to separate the DNA solution and stored at -20ºC until use. 3.3.5.2 The method of sequencing 16S rRNA gene of bacteria 10 bacterial samples selected isolated from the results identified by the method of 16S rRNA gene sequencing include: B1-6T; B2-5G; B2- 3TT; B6-9TT; A1F1; A1F2; A1F4; A1F6; A1F9; A5F4. The PCR product samples were sent to laboratory NK-Biotek and R & D units of companies Nam Khoa. Sequencing products were run electrophoresis sequencing machine ABI 3130XL sequencer 16 capillar. The results sequencing of 16S rRNA gene were compared using the program Blast search on the database of NCBI gene bank. 3.3.6 The method histopathology The number of samples analyzed, including 127 fish. Sampling gill tissue, liver, kidney of healthy fish and fish disease. The samples were cut to a thickness of 5-7 mm, and then processed by automated handling machines through stages dehydrate, making the coated sample and paraffin. Casting blocks and cut with a thickness of 4-6 μm, to dye the samples by Haematocyline and Eosin (H & E). Read the results by the microscope and based on the document of Ferguson (2006) (cited by Dang Thi Hoang Oanh, 2011). 3.3.7 The method hematology 3.3.7.1 The method analyze blood samples of fish The number of samples analyzed blood samples is 102 fish. Blood was taken from the aorta at the tail of fish (Houston, 1990). To spread the blood sample on lame. The blood sample after being fixed by soaking in methanol for 1-2 minutes (Rowley, 1990). 3.3.7.2 The quantification of erythrocyte Red blood cells (RBC) are counted by the erythrocyte count chamber at 40X of the microscope. The formula for calculating the red blood cell: R = C x 10 x 5 x 200 Notes: R: red blood cell (cells/mm3); C: total hemoglobin count on five areas; 10: spacing lamellae and counting chamber is 0.1 mm; 5: The area of each zone is 0,2 mm 2 ; 200: red blood cell dilution. 3.3.7.3 Qualitative and quantitative leukocyte Staining pattern: sample dyeing method Wright's & Giemsa (Humason, 1997 cited by Rowley, 1990). Observation under the microscope at 100X (Supranee et al., 1991). 5 Total leukocytes (TBC) = (Leukemia in 1500 cells x the density of red blood on chamber RBC)/RBC in 1500 on a sample cell dye. The density of each type (cells/mm 3 ) = The number of each type of leukocytes x density total leukocytes / 200. 3.3.8 The rapid diagnostic method hemorrhage 3.3.8.1 The method of bacterial DNA extraction: (same 3.3.5.1) 3.2.8.2 The method of the kidney tissue DNA extraction Based on the method Phenol chloroform extraction of Taggart et al. (1992) (to adjust by Dang Thi Hoang Oanh Dang and Dang Thuy Mai Thy, 2009) to extract DNA fish kidney. 3.3.8.3 The method of DNA amplification PCR amplified 16S rRNA gene was performed according to the process of Nunan et al. (2003). The molecular weight of the DNA fragments to detect S. dysgalactiae is 1500 bp. The primer is used in PCR amplification 16S rRNA gene designed by Zinniel et al., (2002) Primer 1: p515FPL 5'-GTGCCAGCAGCCGCGGTAA- 3 ', Primer 2: p13B 5'AGGCCCGGGAACGTATTCAC-3 '. 3.3.8.4 The PCR detected S. dysgalactiae PCR using primers STRD-DYI/dys-16S-23S-2 according to Hassan et al. (2003): STRD-DYI: "5 'TGGAACACGTTAGGGTCG 3'" 16S-23S-dys-2: "5 'CTTAACTAGAAAAACTCTTGATTATTC 3'" PCR detects S. dysgalactiae bacteria based of Hassan et al. (2003), the positive control used in PCR detection of bacteria is S. dysgalactiae, that was identified by decoding 16S rRNA sequencing is B2-5G. 3.3.8.5 The method of electrophoresis Using 10 l PCR products were run electrophoresis on 1.5% agarose gel (ABgene, UK) in the buffer x 1 TAE (10 mM Tris, 5 mM acetate, 0.1 mM EDTA). 3.3.8.6 The method of determining the sensitivity of PCR detected S. dysgalactiae 0.5 g kidney tissue of fish mixed bacteria with density 25 ng, 50 ng, 100 ng, 200 ng, 400 ng, 800 ng, 1.600 ng and 3,200 ng used for PCR to detect S. dysgalactiae. 3.3.8.7 The method of determining the specificity of PCR detection S. dysgalactiae Using PCR primers in detecting S. dysgalactiae to detect five different types of bacteria including Vibrio parahaemolyticus, Edwardsiella ictaluri, Aeromonas hydrophilla, Streptococcus agalactiae, Flavobacterium 6 columnare. The positive control used PCR detection S. dysgalactiae, it was identified by decoding 16S rRNA sequencing is B2-5G. 3.3.8.8 The applicability of PCR detection process S. dysgalactiae The ability to process applications in multiple strains of S. dysgalactiae and kidney of fish. 3.3.9 The method of antimicrobial susceptibility According to the method of Geert Huy, 2002. 3.3.9.1 The method of bacterial recovery Bacteria keeps at -80 o C, recovered on TSA (+1.5% NaCl) and incubated at 30°C after 48 hours. 3.3.9.2 The method of antimicrobial susceptibility Using pipette 0,1 ml bacteria MHA (+1.5% NaCl) and spread, use pen takes antibiotic into a petri dish. Each petri dish paste four antibiotic discs. Place the plate in an incubator at 30°C. Read the results after 48 hours. 3.3.9.3 The methods for determination of minimum inhibitory concentration (MIC) of antibiotics The minimum inhibitory concentration (MIC) of antibiotics on bacteria is determined by the method of Geert Huys (2002). 3.3.10 The method of arrangement laboratory 3.3.10.1 The preparation of experiment Laboratory instruments such as plastic tanks 500 L, 60 L, aeration tubing, racket, pumice stone ... be cleaned with soap and 200 ppm chlorine, drying. Then water is about 2/3 tank, aeration. Water supply to 1/3 plastic bucket. Water resource use is water salinity 10 ‰. 3.3.10.2 The fish for laboratory Mudskipper are the same size, strong, flexible, light-skin, weight 15- 20 g/fish. The fish are fed in 500 L plastic tanks, aeration of about 1 week. Check the health of fish (randomly selected 5 fish) before the experiment. 3.3.10.3 The Preparation bacterial infect with fish Bacteria are stored on TSA (+1.5% NaCl) (TSA + ), incubated at 28°C. Overgrowth, then, bacteria were centrifuged at a speed of 5,000 cycles/min at 4°C for 5 minutes. Counting bacterial density by colorimetric spectrophotometer at 610 nm. Bacterial solution is diluted 10 times (1 ml of 1 x 10 9 CFU/ml + 9 ml physiological saline) to be the density of 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 CFU/ml. 3.3.10.4 The method arrange susceptibility experiment The experiment infection was random with 4 treatments of 4 strains B1-6T, B2-3TT, B2-5G, B6-9TT injection density is 10 8 CFU/fish and 7 physiological saline in the control treatment. Fish were injected 0.1 ml/fish at the fin. Each treatment repeated 3 times with a density of 10 fish/tank. After injection, the expression of fish is monitored continuously for 7 days. End of experiment, in each treatment shall collect tissue samples (3 fish/treatments) in the organs gills, liver and kidneys. 3.3.10.5 The method laboratory determined LD50 Experimentally determined LD50 is completely random using 02 strains B1-6T and B2-5G. Fish experiments were injected 0,1 ml/fish. Each treatment repeated 3 times with a density of 20 fish/tank. Treatment 1, 2, 3, 4, 5, 6, 7: The fish are injected with a density of 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 CFU/fish. Treatment 8: control treatment: The fish are injected with saline. After injection, the expression of fish is monitored continuously for 14 days. The concentration of bacteria lethal to 50% of fish experiment (LD50) was determined according to Reed and Muench formula (1938): LD50 = 10 a – p.d Notes: p.d = (L% - 50%) / (L% - H%) a: The powers at which the bacteria die lowest fish (over 50%) H%: Proportion of the highest mortality (below 50%); L%: Percentage of the lowest mortality (over 50%). 3.3.10.6 The method arrange the experiment treat hemorrhagic in the laboratory - The bacteria that cause infection are B1-6T, injection density is 10 4 CFU/fish. The experimental period was 21 days. - Antibiotics: DO and FFC used in experiments are antibiotics of UV company: DO and FFC in the form, materials; DO with the trade name Rydoxyne and FFC with the trade name of the UV-Flo. - The drug was mixed into fish food, drug content of 20 mg/kg weight of the fish. Feeding on demand. The experiment includes 7 treatments, each treatment was arranged 30 fish, repeated 3 times. - Fish in treatments 1, 2, 3, 4 are infected the first day and the third day provides food mix with antibiotics. Feeding continuously for 5 days. Treatment 1 use DO material, treatment 2 uses DO product; treatment 3 use FFC material and treatment 4use FFC product. - Treatment 5: Control 1: Fish are infect the first day and food do not mix antibiotic. - Treatment 6: Control 2: Fish are injected saline and food do not mix antibiotic. 8 - Treatment 7: Control 3: Fish are not infected bacteria, not saline, feeding not mix antibiotic. - Subscribe to daily mortality, recorded and photographed pathological signs outside and inside. End of an experiment conducted to collect bacteria samples, histology (3 fish/treatment). - The effectiveness of the treatment in the lab was evaluated by the relative survival rate (RPS%) according to the formula (Ellis, 1996): 4. Methods of data analysis Thesis data aggregated and processed using Microsoft Excel, SPSS statistical version 20. The result sequencing of 16S gene segments was compared using the program Blast search on the database of NCBI gene bank online. The thesis is presented in Microsoft Word. Chapter 4. RESULTS AND DISCUSSIONS 4.1 The isolation and identification bacteria cause hemorrhagic disease in mudskipper 4.1.1 The situation of culture and diseases in mudskipper 4.1.1.1 The experience of mudskipper farmers The households are surveyed, they have the experience concentrate 2 years (23.3%) and 3, 4 years (20%) (Table 4.1) Table 4.1 The experience of mudskipper farmers The experience (year) Farmers Rate (%) 1 2 3 4 5 6 7 8 21 18 18 12 11 2 8,9 23,3 20 20 13,3 12,2 2,3 4.1.1.2 Farming area Popular culture area from 1000-5000 m 2 (34.5%). The number of farms with large area fairly high percentage shows farmers tends to expand farming area (Table 4.2). Table 4.2 Farming areas Farming area (m2) Farmers Rate (%) ≤ 5.000 ≤ 10.000 ≤ 15.000 ≤ 20.000 > 20.000 31 25 12 11 11 34,5 27,8 13,3 12,2 12,2 RPS (%) = % mortality in medicine group 1- x 100 % mortality in control group 9 4.1.1.3 Crop and time Crop started from June to February, March. 4.1.1.4 Fishing techniques a. The process of arrangement and improvement pond Most households improve pond by dried (86.7%), the remaining let some of the water in the pond and conduct liming (13.3%) (Table 4.3) Table 4.3 The step of improvement pond The step of arrangement pond Farmers Rate (%) Drying pond Yes 78 86,67 No 12 23,33 Liming Yes 64 71,11 No 26 28,89 Fertilizer Yes 7 7,78 No 83 92,22 To kill other fish Yes 55 61,11 No 35 38,89 Sterilize Yes 45 50 No 45 50 Pure water Yes 15 16,67 No 75 83,33 b. The source of breeding and stocking density Mudskipper juvenile source depends on the wild resources. Stocking density of 50 - 200 fish/m 2 , the majority of households in stocking density from 100-150 fish/m 2 (82.2%) (Table 4.4). Table 4.4 Stocking density Stocking density (fish/m2) Farmers Rate (%) < 100 100 - 150 > 150 5 74 11 5,56 82,22 12,22 c. Food and feeding Frequency of feeding ranged from 2-5 times/day. There are 56.7% of surveyed households feeding 2 times/day in the morning and afternoon. The weight of food to feed depends on the needs of fish, households should have a continuous feeding of the day (each separated by 2 or 3 hours) (8.89%) (Figure 4.1) Figure 4.1. Frequency of feeding d. Management o
Luận văn liên quan