Tóm tắt Luận án Đặc điểm ngoại hình, đa hình gen và ứng dụng chỉ thị phân tử trong chọn lọc cải thiện năng suất sinh sản của gà nòi

Trong chăn nuôi gia cầm, năng suất sinh sản là một chỉ tiêu kinh tế quan trọng và bị chi phối bởi các yếu tố môi trường, thành phần dinh dưỡng trong thức ăn (Liu et al., 2004; Lewis and Gous, 2006) và nội tiết (Kim et al., 2004. Nhiều nghiên cứu cho thấy các yếu nội tiết liên quan đến năng suất sinh sản đươc điều khiển bởi nhiều gen kh ̣ ác nhau (Emsley, 1997; Luo et al., 2007): gen Prolactin (Cui et al., 2006), Vasoactive Intestinal Poly-peptide (Li et al. 2009; Caldwellet al., 1999; Zhou et al., 2010), Gen Bone Morphogenntic Poteins (Zhang et al., 2008), Neuropeptide Y (Fatemi et al., 2012), Melatonin Receptor (Li et al., 2013). Việc đánh giá sự tác động của đa hình trên các gen này đến năng suất sinh sản gà có thể đẩy nhanh tốc độ và nâng cao sự đồng đều của quá trình chọn giống nhằm nâng cao năng suất sinh sản của chúng. Thêm vào đó, ở gà Nòi rất ít các nghiên cứu về di truyền ở mức độ phân tử và hầu như chưa có một công bố nào về tính đa dạng di truyền cũng như vai trò của một số gen ứng viên liên quan đến tiềm năng sinh sản của dòng gà địa phương này. Vì vậy việc nghiên cứu đa hình di truyền và sử dụng chỉ thị phân tử trong chọn lọc để nâng cao các tính trạng năng suất sinh sản là cần thiết. Chính vì những lý do trên đề tài “Đặc điểm ngoại hình, đa hình gen và ứng dụng chỉ thị phân tử trong chọn lọc cải thiện năng suất sinh sản của gà Nòi” được thực hiện.

pdf27 trang | Chia sẻ: thientruc20 | Ngày: 21/08/2021 | Lượt xem: 92 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Tóm tắt Luận án Đặc điểm ngoại hình, đa hình gen và ứng dụng chỉ thị phân tử trong chọn lọc cải thiện năng suất sinh sản của gà nòi, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC CẦN THƠ TÓM TẮT LUẬN ÁN TIẾN SĨ Chuyên ngành: Chăn nuôi Mã ngành: 62.62.01.05 CHÂU THANH VŨ ĐẶC ĐIỂM NGOẠI HÌNH, ĐA HÌNH GEN VÀ ỨNG DỤNG CHỈ THỊ PHÂN TỬ TRONG CHỌN LỌC CẢI THIỆN NĂNG SUẤT SINH SẢN CỦA GÀ NÒI Cần Thơ- 2018 CÔNG TRÌNH ĐƯỢC HOÀN THÀNH TẠI TRƯỜNG ĐẠI HỌC CẦN THƠ Người hướng dẫn khoa học: PGS.TS. NGUYỄN TRỌNG NGỮ TS. NGUYỄN THỊ HỒNG NHÂN Luận án được bảo vệ trước hội đồng chấm luận án tiến sĩ cấp trường Họp tại: phòng khu II, Trường Đại học Cần Thơ Vào lúc giờ ngày tháng năm Phản biện 1: Phản biện 2: Phản biện 3: Xác nhận đã xem lại của Chủ tịch Hội đồng Có thể tìm hiểu luận án tại thư viện: 1. Trung tâm Học liệu, Trường Đại học Cần Thơ. 2. Thư viện Quốc gia Việt Nam. DANH MỤC LIỆT KÊ CÁC BÀI BÁO ĐÃ CÔNG BỐ Các bài báo đăng trên tạp chí: 1. Chau Thanh Vu and Nguyen Trong Ngu, 2016. Single nucleotide polymorphisms in candidate genes associated with egg production traits in native Noi chicken of Vietnam. International Journal of Plant, Animal and Environmental Sciences, Volume-6, Issue-1, 162-169. 2. Châu Thanh Vũ, Nguyễn Thị Hồng Nhân và Nguyễn Trọng Ngữ, 2017. Đa hình GH/MSPI liên kết với các tính trạng sản xuất trứng của gà Nòi. Tạp chí KHKT Chăn nuôi số 220. Chương I. GIỚI THIỆU 1.1 Tính cấp thiết của luận án Trong chăn nuôi gia cầm, năng suất sinh sản là một chỉ tiêu kinh tế quan trọng và bị chi phối bởi các yếu tố môi trường, thành phần dinh dưỡng trong thức ăn (Liu et al., 2004; Lewis and Gous, 2006) và nội tiết (Kim et al., 2004. Nhiều nghiên cứu cho thấy các yếu nội tiết liên quan đến năng suất sinh sản đươc̣ điều khiển bởi nhiều gen khác nhau (Emsley, 1997; Luo et al., 2007): gen Prolactin (Cui et al., 2006), Vasoactive Intestinal Poly-peptide (Li et al. 2009; Caldwellet al., 1999; Zhou et al., 2010), Gen Bone Morphogenntic Poteins (Zhang et al., 2008), Neuropeptide Y (Fatemi et al., 2012), Melatonin Receptor (Li et al., 2013). Việc đánh giá sự tác động của đa hình trên các gen này đến năng suất sinh sản gà có thể đẩy nhanh tốc độ và nâng cao sự đồng đều của quá trình chọn giống nhằm nâng cao năng suất sinh sản của chúng. Thêm vào đó, ở gà Nòi rất ít các nghiên cứu về di truyền ở mức độ phân tử và hầu như chưa có một công bố nào về tính đa dạng di truyền cũng như vai trò của một số gen ứng viên liên quan đến tiềm năng sinh sản của dòng gà địa phương này. Vì vậy việc nghiên cứu đa hình di truyền và sử dụng chỉ thị phân tử trong chọn lọc để nâng cao các tính trạng năng suất sinh sản là cần thiết. Chính vì những lý do trên đề tài “Đặc điểm ngoại hình, đa hình gen và ứng dụng chỉ thị phân tử trong chọn lọc cải thiện năng suất sinh sản của gà Nòi” được thực hiện. 1.2 Mục tiêu của luận án -Xác định đặc điểm ngoại hình và đánh giá đa dạng di truyền giữa các nhóm gà Nòi tại ĐBSCL - Xác định sự ảnh hưởng của một số gen ứng viên liên quan đến năng suất sinh sản ở gà Nòi. - Chọn tạo để cải thiện năng suất sinh sản gà Nòi. 1.3 Những đóng góp mới của luận án (i) Đề tài đã xác định được một số đặc điểm ngoại hình của các nhóm gà Nòi được nuôi tại 6 tỉnh Cần Thơ, Sóc Trăng, Kiên Giang, Bến Tre, Trà Vinh, Đồng Tháp thuộc Đồng bằng sông Cửu Long. Bên cạnh đó, đề tài cũng đã xác định được tính đa dạng di truyền giữa các nhóm 2 gà Nòi tại ĐBSCL góp phần trong việc nhận biết mối quan hệ về mặt di truyền của các nhóm gà khảo sát. (ii) Sử dụng phương pháp phân tử để xác định các đột biến trên các gen ứng viên và ảnh hưởng của chúng đến khả năng sinh sản gà Nòi. Qua đó đã tìm được mối liên quan giữa một số đa hình gen đến năng suất sinh sản của gà Nòi. (iii) Dựa vào mối liên kết của các đốt biến với các tính trạng kiểu hình chọn lọc được các cá thể gà Nòi mang kiểu gen cho năng suất sinh sản cao. 1.4 Ý nghĩa thực tiễn và khả năng ứng dụng của luận án Xác định được tính đa dạng di truyền và chọn lọc được các nhóm gà Nòi có khả năng sinh sản cao bằng chỉ thị phân tử nhằm phục vụ cho ngành chăn nuôi gà tại ĐBSCL. Chương 3. PHƯƠNG TIỆN VÀ PHƯƠNG PHÁP NGHIÊN CỨU Đề tài được thực hiện trên 3 nội dung: 3.1 Nội dung 1: Điều tra đặc điểm ngoại hình và phân tích đa dạng di truyền giữa các nhóm gà Nòi tại ĐBSCL 3.1.1 Ghi nhận đặc điểm ngoại hình gà Nòi * Địa điểm điều tra: Đồng Tháp; Bến Tre; Trà Vinh; Kiên Giang; Sóc Trăng, Cần Thơ * Phương pháp chọn hộ điều tra: Choṇ ngẫu nhiên 20 hô/̣tỉnh với 2 tiêu chí kinh nghiêṃ chăn nuôi hơn 5 năm và qui mô chăn nuôi từ 100 con/hộ * Chọn gà: xác định đặc điểm ngoại hình của 60 cá thể gà Nòi/tỉnh (3 cá thể/hộ) từ 1 đến 2 năm tuổi * Chỉ tiêu ghi nhận: đặc điểm ngoại hình được xác định theo Bùi Hữu Đoàn và ctv. (2011). 3.1.2 Đánh giá đa dạng di truyền giữa các nhóm gà Chọn ngẫu nhiên 60 cá thể gà Nòi (10 cá thể/tỉnh * 6 tỉnh) để xác định đa dạng di truyền bằng cách sử dụng 10 primer microsatellite. *Tách chiết ADN từ lông: mẫu lông được tách chiết bằng proteinase K, sử dụng nồng độ muối cao để loại bỏ protein. 3 *Phương pháp PCR: Trình tự các primer microsallite trong nghiên cứu sử dụng theo khuyến cáo của ISAG/FAO dùng cho phân tích đa daṇg di truyền trên gà (Bảng 3.1). Bảng 3.1: Thông tin của các chỉ thị microsatellite được sử dụng theo khuyến cáo của ISAG/FAO Tên NST Trình tự mồi(5’->3’) Tm (°c)* Vùng alen(bp) ADL 0268 1 F: CTCCACCCCTCTCAGAACTA R: CAACTTCCCATCTACCTACT 60 102-116 MCW0081 5 F: GTTGCTGAGAGCCTGGTGCAG R: CCTGTATGTGGAATTACTTCTC 60 112-135 MCW0183 7 F: ATCCCAGTGTCGAGTATCCGA R: TGAGATTTACTGGAGCCTGCC 58 296-326 MCW0067 10 F: GCACTACTGTGTGCTGCAGTTT R: GAGATGTAGTTGCCACATTCCGAC 60 176-186 MCW0330 17 F: TGGACCTCATCAGTCTGACAG R: AATGTTCTCATAGAGTTCCTGC 60 256-300 MCW0069 23 F: GCACTCGAGAAAACTTCCTGCG R: ATTGCTTCAGCAAGCATGGGAGGA 60 158-176 MCW0034 2 F: TGCACGCACTTACATACTTAGAGA R: TGTCCTTCCAATTACATTCATGGG 60 212-246 MCW0016 3 F: ATGGCGCAGAAGGCAAAGCGATAT R: TGGCTTCTGAAGCAGTTGCTATGG 60 162-206 ADL 112 10 F: GGCTTAAGCTGACCCATTAT R: ATCTCAAATGTAATGCGTGC 58 120-134 MCW 216 13 F: GGGTTTTACAGGATGGGACG R: AGTTTCACTCCCAGGGCTCG 58 139-149 F: mồi xuôi; R: Mồi ngược; *: Nhiệt độ bắt cặp Thành phần cho một phản ứng PCR bao gồm: 1X PCR buffer, 2,5 mM MgCl2, 0,25 mM dNTP, 0,25 pmol mỗi mồi, 0,5 U Taq ADN polymerase, 100 ng ADN mẫu và thêm nước vừa đủ 10 µl. Chu trình nhiệt cho một phản ứng PCR: biến tính ban đầu ở 95oC trong 3 phút, 35 chu kỳ bao gồm 95oC cho 45 giây, nhiệt độ tối ưu cho từng primer trong 45 giây, kéo dài ở 72oC trong 45 giây và kéo dài cuối cùng ở 72oC trong 10 phút. Điên di trên gel polyacrylamide: Sản phẩm PCR được điện di trên gel polyacrylamide 10%, kết quả được đọc dựa vào kích thước các đoạn ADN trên gel. 4 3.2 Nội dung 2: Xác định đa hình gen ứng viên và đánh giá năng suất sinh sản ở gà Nòi thế hệ xuất phát 3.2.1 Đánh giá năng suất sinh sản của gà Nòi *Gà thí nghiệm: 2.000 gà Nòi 1 ngày tuổi (thu thập từ 4 cơ sở ấp trứng gà Nòi, mỗi điểm 500 con) được nuôi dưỡng ở cùng một chế độ chăm sóc. Giai đoạn 1-15 tuần tuổi: nuôi nhốt tập trung, mật độ 8 con/m2. Chọn lọc 240 gà Nòi (200 mái và 40 trống) dựa vào đặc điểm kiểu hình về tiêu chuẩn giống lúc 16 tuần tuổi. Giai đoạn 16-21 tuần tuổi: gà được nuôi nhốt tập trung với mật độ 4 con/m2. Giai đoạn 22-75 tuần tuổi: Gà thí nghiệm được nuôi trên chuồng lồng dành cho gà mái đẻ công nghiệp. Ghi nhận các chỉ tiêu năng suất sinh sản trong 12 tháng đẻ. Các chỉ tiêu được tính theo Bùi Hữu Đoàn và ctv. (2011) 3.2.2 Xác định đa hình gen ứng viên Gà trong nghiên cứu (200 gà mái và 40 gà trống) được thu mẫu, ly trích và kiểm tra chất lượng ADN tương tự như nội dung 1. Bảng 3.2. Trình tự mồi của các gen nghiên cứu Gen Trình tự mồi (5’ – 3’) Kích thước (bp) Enzyme TK PRL F:AGAGGCAGCCCAGGCATTTTAC R:CCTGGGTCTGGTTTGGAA ATTG 439 AluI Cui et al., 2006 F:AGAGGCAGCCCAGGCATTTTAC R:CCTGGGTCTGGTTTGGAA ATTG 439 Csp6I VIP F: GCTTGGACTGATGCGTACTT R: GTATCACTGCAAATGCTCTGC 520 ApoI Xu et al., 2011b BMPR- IB F: CCATAGCAAAACAGATTCAG R: TCAGGA CAGTTTGGTAGATT 581 Hind III Zhang et al. 2008 MTRN1C F: GGTGTATCCGTATCCTCTAA R: GACAGTGGGACAATGAAGT 373 MboI Liet al., 2013 GH F: CTAAAGGACCTGGAAGAAGGG R: AACTTGTCGTAGGTGGGTCTG 1164 SacI Makhsous et al., 2013 F: CTAAAGGACCTGGAAGAAGGG R: AACTTGTCGTAGGTGGGTCTG 1164 MspI Makhsous et al., 2013 NPY F: TCTCAGAGCTCCAACGTATGA R:ATATTTCTGTGCCTGAACAACA 240 DraI Xu et al., 2011b F: mồi xuôi; R: mồi ngược; TK: tài liệu tham khảo 5 Gà thí nghiệm được phân tích kiểu gen bằng phương pháp PCR- RFLP. Phương pháp PCR thực hiện tương tự như nội dung 1 nhưng khác ở trình tự các primer (Bảng 3.2) và chu trình nhiệt (Bảng 3.3). Sản phẩm PCR được ủ với enzyme chuyên biệt cho từng cặp mổi. Sau đó, sản phẩm được kiểm tra trên gel agarose 2%. Bảng 3.3: Chu trình nhiệt cho phản ứng PCR tối ưu cho từng đa hình Giai đoạn Đa hình Chu kỳ PRL VIP và BMPR-IB MTRN1C GH NPY 1 94oC –5’ 94oC – 4’ 94oC –5’ 94oC –5’ 94oC – 4’ 1 94oC – 30’’ 94oC – 60’’ 94oC – 30’’ 94oC – 30’’ 94oC – 45’’ 2 58oC – 60’’ 57oC – 45’’ 57oC – 45’’ 58oC – 30’’ 56oC – 45’’ 35 72oC – 30’’ 72oC – 60’’ 72oC – 50’’ 72oC – 2’ 72oC – 45’’ 3 72oC – 5’ 72oC – 10’ 72oC – 5’ 72oC – 10’ 72oC – 5’ 1 3.3 Nội dung 3: Chọn tạo để cải thiện năng suất sinh sản và đánh giá năng suất sinh sản của gà Nòi ở thế hệ 1 Chọn tạo gà Nòi mang các kiểu gen cho năng suất trứng cao Quần thể gà Nòi trong nghiên cứu (nội dung 2) được chọn lọc định hướng nhằm nâng cao năng suất trứng và số lượng gà con sinh ra/gà mái. Dựa vào kết quả từ nội dung 2 chọn những cá thể gà trống và mái Nòi ở thế hệ xuất phát để chọn tạo thu thế hệ 1. - Đối với gà mái: Sau khi kết thúc nội dung 2 tiến hành chọn 24 gà mái với tỷ lệ chọn lọc là 12% (chọn 24 con mái/200 con mái), các gà mái được chọn phải thỏa 2 điều kiện sau: 1. Mang kiểu gen cho năng suất trứng và số lượng gà con sinh ra cao (gà mang kiểu gen đồng hợp DD ở đa hình NPY/DraI ). 2. Từ 67 gà mái mang kiểu gen DD ở đa hình NPY/DraI chọn 24 gà mái cho năng suất trứng cao nhất. - Đối với gà trống: chọn 3 gà trống mang kiểu gen giống với gà mái được chọn để tạo ra dòng gà mái có kiểu gen thuần. Sơ đồ bố trí thí nghiệm: Ghép các cá thể gà được chọn thành 3 gia đình (1 trống và 8 mái/gia đình, Bảng 3.4). Mỗi gia đình tạo 22 gà mái và theo dõi năng suất sinh sản đến tháng đẻ thứ 6. 6 Bảng 3.4. Sơ đồ bố trí thí nghiệm Chỉ tiêu Gà trống Tổng A B C 3 Số gà mái/gà trống 8 8 8 24 Số gà con/gà trống 22 22 22 66 Theo dõi các chỉ tiêu sinh sản của gà Nòi ở thế hệ 1: chế độ nuôi dưỡng, các chỉ tiêu theo dõi năng suất sinh sản gà mái ở các gia đình tương tự như nội dung 2. 3.3 Xử lý số liệu Sử dụng phần mềm Minitab 16 để phân tích mối liên kết giữa kiểu gen và các chỉ tiêu ghi nhận được theo mô hình thống kê: Yij = µ + Ai+ij Trong đó: Yij: Tính trạng quan sát, µ là trung bình chung, Ai là tác động của kiểu gen, , ij là sai số ngẫu nhiên. Số liệu được xử lý sơ bộ bằng phần mềm Microsoft Excel; phân tích đa dạng di truyền bằng phần mềm Biodiversity Pro; tần số alen, tần số kiểu gen, kiểu gen dị hợp tử mong đợi (He), kiểu gen dị hợp tử quan sát (Ho), đánh giá mức khác biệt bên trong và giữa các quần thể, các giá trị thống kê F (FIS, FST); test cân bằng Hardy–Weinberg (HWE) được xác định bằng phần mềm Genpop V4.2 và phần mềm Fstat V2.9.3. Chương IV. KẾT QUẢ VÀ THẢO LUẬN 4.1 Đặc điểm ngoại hình và phân tích đa dạng di truyền giữa các nhóm gà Nòi tại ĐBSCL 4.1.1 Đặc điểm ngoại hình Nghiên cứu hiện tại tiến hành điều tra khảo sát đặc điểm ngoại hình của 815 cá thể gà (268 gà trống và 547 gà mái) tại các tỉnh ở ĐBSCL. Kết quả được ghi nhận được trình bày trong Bảng 4.1 và Hình 4.1. Đặc điểm ngoại hình của gà Nòi rất phong phú và đa dạng, tuy nhiên sự phân bố các tính trạng là không đồng đều do sự chi phối của quá trình lai tạo và chọn lọc nhân tạo. Có thể thấy các đặc điểm như màu lông và kiểu mào chịu sự chi phối rõ rệt của giới tính, điều này có ý nghĩa quan trọng đối với việc lai tạo các nhóm gà Nòi nhằm vào các mục đích khác nhau. 7 Hình 4.1. Một số kiểu hình đặc trưng về màu sắc lông, màu mắt, màu mỏ, màu da chân và kiểu mào của gà Nòi 8 Bảng 4.1: Phân bố đặc điểm ngoại hình của gà Nòi Chỉ tiêu Gà trống (n=268) Gà mái (n=547) Tổng cộng (n=815) Số lượng Tỷ lệ (%) Số lượng Tỷ lệ (%) Số lượng Tỷ lệ (%) Màu lông Đen đỏ (gà điều) 113 42,2 12 2,2 125 15,3 Đen (gà ô) 25 9,3 70 12,8 95 11,7 Đen trắng 17 6,3 10 1,8 27 3,3 Nâu 13 4,9 304 55,6 317 38,9 Trắng (gà nhạn) 27 10,1 18 3,3 45 5,5 Vàng 38 14,2 59 10,8 97 11,9 Xám tro 20 7,5 32 5,9 52 6,4 Màu khác 15 5,6 42 7,7 57 7,0 Màu mắt Vàng 82 30,6 306 55,9 388 47,6 Vàng đen 53 19,8 74 13,5 127 15,6 Vàng cam 114 42,5 127 23,2 241 29,6 Nâu đen 15 5,6 26 4,8 41 5,0 Màu khác 4 1,5 14 2,6 18 2,2 Màu mỏ Vàng 40 14,9 154 28,2 194 23,8 Vàng đen 121 45,1 106 19,4 227 27,9 Trắng ngà 31 11,6 146 26,7 177 21,7 Đen 73 27,2 120 21,9 193 23,7 Màu khác 3 1,1 21 3,8 24 2,9 Màu da chân Vàng 114 42,5 255 46,6 369 45,3 Xanh 36 13,4 150 27,4 186 22,8 Chì 34 12,7 59 10,8 93 11,4 Vàng cam 16 6,0 11 2,0 27 3,3 Trắng 53 19,8 55 10,1 108 13,3 Màu khác 15 5,6 17 3,1 32 3,9 Kiểu mào* Trích 69 29,0 132 48,5 201 39,4 Dâu 85 35,7 37 13,6 122 23,9 Lá 74 31,1 26 9,6 100 19,6 Trà 10 4,2 4 1,5 14 2,7 Không mào 0 0,0 73 26,8 73 14,3 *Gà trống n=268; Gà mái n=547; Tổng cộng n=815 4.1.2 Đặc điểm khối lượng và các chiều đo của gà Nòi trưởng thành Từ kết quả ở Bảng 4.2 cho thấy số đo ở các chi như chiều dài cánh, chiều dài đùi, vòng đùi, chiều cao chân, vòng ống chân ở gà Nòi đều cao và ở gà Nòi trống cao hơn so với gà Nòi mái. Đáng lưu ý nhất là chiều dài cánh, dài đùi và vòng đùi ở gà Nòi trống lần lượt là 24,13cm, 9 16,33 cm và 15,53 cm có sự chênh lệch rõ rệt so với ở gà Nòi mái (20,86 cm, 13,66 cm và 11,55 cm). Đây là các bộ phận có giá trị kinh tế cao trong sản phẩm gia cầm, giúp định hướng việc chọn lọc giống gà hướng thịt. Bảng 4.2: Khối lượng và các chiều đo của gà Nòi trưởng thành (Mean ± SE) Chỉ tiêu Gà trống (n=32) Gà mái (n=272) Khối lượng (kg) 2,89 ± 0,30 1,77 ± 0,26 Cao đầu (cm) 4,00 ± 0,26 3,39 ± 0,18 Rộng đầu (cm) 3,70 ± 0,25 3,18 ± 0,20 Dài cổ (cm) 18,73 ± 1,59 16,27 ± 1,57 Vòng cổ (cm) 11,83 ± 0,93 8,65 ± 0,78 Dài thân (cm) 19,85 ± 1,67 17,83 ± 1,88 Dài lườn (cm) 14,11 ± 1,04 11,70 ± 1,12 Vòng ngực (cm) 34,67 ± 1,92 29,85 ± 1,93 Góc ngực (o) 65,41 ± 6,38 62,81 ± 7,03 Sâu ngực (cm) 12,77 ± 1,67 10,33 ± 1,26 Dài cánh (cm) 24,13 ± 1,82 20,86 ± 2,07 Dài đùi (cm) 16,33 ± 0,99 13,66 ± 1,47 Vòng đùi (cm) 15,53 ± 1,42 11,55 ± 1,22 Khoảng cách bụng (cm) 4,37 ± 1,13 5,68 ± 1,40 Khoảng cách xương háng (cm) 2,12 ± 1,17 4,07 ± 1,07 Cao chân (cm) 10,37 ± 0,60 8,20 ± 0,69 Vòng ống chân (cm) 5,30 ± 0,35 4,27 ± 0,31 4.1.3 Đánh giá đa dạng di truyền giữa các nhóm gà bằng chỉ thị microsatellite Kết quả ở Hình 4.2 cho thấy phần lớn các kích thước alen của 10 locus microsatellite được xác định trong nghiên cứu hiện tại trên quần thể gà Nòi nằm trong khoảng công bố của FAO (2011) và tương đồng với nghiên cứu của Tadano et al. (2007) trên 12 giống gà ở Nhật Bản, 10 Lê Thị Thúy (2010) trên một số giống gà bản địa của Việt Nam, Nguyễn Trọng Bình và ctv. (2008) trên gà Hà Giang. Hình 4.2. Khuếch đại ADN gà Nòi bằng 10 cặp mồi (gel agarose 5% và polyacrylamide 10%) 11 4.1.4 Đa hình các locus microsatellite trên quần thể gà Nòi Xét trên từng locus microsatellite cho thấy hầu hết các locus đều thể hiện giá trị He cao hơn giá trị Ho, ngoại trừ hai locus MCW0016 và MCW0034. Kết quả phân tích ở Bảng 4.3 cho thấy tần số dị hợp tử quan sát thể hiện cao nhất ở locus MCW0034 (0,924) và thấp nhất là locus MCW0183 (0,146), trong khi đó ở tần số dị hợp tử mong đợi thể hiện cao nhất ở locus MCW0016 (0,846) và thấp nhất ở locus MCW0067 (0,400). Bảng 4.3 cũng cho thấy các locus MCW0016, ADL0268, MCW0081, MCW0216, ADL0112 và MCW0034 có mức độ dị hợp tử tồn tại trong quần thể cao. Bảng 4.3: Tần số dị hợp tử quan sát (Ho) và mong đợi (He), Fis của các microsatellite trên quần thể gà Nòi LocName Số alen Ho He Fis Fst P-value ADL0268 3 0,773 0,692 -0,117 0,023 0,930 MCW0081 5 0,692 0,755 0,084 0,000 0,122 MCW0183 3 0,146 0,431 0,661 0,036 0,002 MCW0067 2 0,257 0,400 0,357 0,16 0,014 MCW0330 5 0,381 0,421 0,094 0,027 0,310 MCW0069 3 0,499 0,720 0,307 0,039 0,002 MCW0034 3 0,924 0,698 -0,324 0,158 0,986 MCW0016 8 0,876 0,846 -0,035 -0,013 0,760 ADL0112 4 0,751 0,765 0,018 -0,029 0,420 MCW0216 2 0,582 0,651 0,106 0,064 0,158 Trung bình 3,8 0,588 0,643 0,085 0,044 0,006 Bên cạnh đó, hệ số cận huyết của mỗi locus có sự sai khác và dao động từ -0,324 đến 0,661 (Bảng 4.3). Xét trên từng vị trí microsatellite, giá trị Fis cao nhất trong quá trình khảo sát là tại locus MCW0183 với giá trị Fis là 0,661; tại locus MCW0067 giá trị Fis là 0,357; tại locus MCW0069 giá trị Fis là 0,307. Trong khi đó ở các locus còn lại giá trị Fis đều thấp hơn 0,2 (Bảng 4.3). Qua kết quả này cho thấy có sự cảnh báo về mức độ thiếu hụt dị hợp tử ở 3 locus MCW0183, MCW0067 và MCW0069. 12 4.1.5 Khoảng cách di truyền của gà Nòi ở sáu tỉnh Đồng bằng sông Cửu Long Kết quả phân tích cho thấy, ở nhóm gà Nòi thuộc tỉnh Trà Vinh, Sóc Trăng, Bến Tre và Kiên Giang có khoảng cách di truyền dao động từ 18,42%-27,03%. Trong đó nhóm gà ở tỉnh Bến Tre và Kiên Giang thể hiện khoảng cách di truyền gần nhất 18,42% với giá trị tương đồng khoảng 81,56% và thể hiện tương đồng 81,15% so với nhóm gà ở Trà Vinh và Sóc Trăng. Xét về tổng thể các nhóm gà Nòi ở 6 tỉnh ĐBSCL thể hiện mức độ tương đồng về mặc di truyền cao (80,12%) (Bảng 4.4). Bảng 4.4:Khoảng cách di truyền giữa các nhóm gà Nòi ở ĐBSCL (%) Kiên Giang Sóc Trăng Cần Thơ Đồng Tháp Trà Vinh Bến Tre Kiên Giang * 18,92 27,03 24,32 18,92 18,42 Sóc Trăng * * 20,00 22,22 21,62 21,05 Cần Thơ * * * 15,15 34,21 24,32 Đồng Tháp * * * * 31,58 21,62 Trà Vinh * * * * * 21,05 Bến Tre * * * * * * Hình 4.3. Cây quan hệ di truyền của 6 nhóm gà Nòi dựa trên số liệu phân tích ADN với 10 chỉ thị microsatellte Cây phân loại di truyền của các nhóm gà Nòi thuộc 6 tỉnh ở ĐBSCL được xây dựng dựa trên khoảng cách di truyền bằng phần mềm Biodiversity Pro. Kết quả cho thấy, ở mức độ tương đồng di truyền 80,12%. Các nhóm gà trong nghiên cứu có thể chia làm hai dòng chính: dòng 1 gồm các nhóm gà ở Cần Thơ, Đồng Tháp và dòng 2 gồm các 13 nhóm gà ở Trà Vinh, Sóc Trăng, Bến Tre và Kiên Giang. Khoảng cách di truyền của các nhóm gà dao động từ 15,15% đến 34,21%. 4.2. Đánh giá năng suất sinh sản ở gà Nòi thế hệ xuất phát và xác định đa hình gen ứng viên 4.2.1 Đánh giá năng suất sinh sản của gà Nòi thế hệ xuất phát Kết quả Bảng 4.5 cho thấy tổng số trứng qua 12 tháng đẻ của gà Nòi là 94,5 quả với khối lượng trứng trung bình 45,4 g, tỷ lệ có phôi đạt 83,3%, tỷ lệ nở/trứng có phôi là 85,3% và số gà con sinh ra là 61,1 con. Bảng 4.5: Năng suất sinh sản của gà Nòi qua 12 tháng đẻ 4.2.2 Tác động của các đa hình ở một số gen tiềm năng lên năng suất sinh sản của gà Nòi Hình 4.4 cho thấy kết quả điện di của các sản phẩm PCR được cắt bằng các enzyme chuyên biệt cho tùng đa hình. Các kiểu gen khác nhau cho kích thước các băng khác nhau trên gel. Kết quả nhận diện các đa hình trong nghiên cứu bằng kỹ thuật PCR PCR-RFLP được trình bày ở Hình 4.4 Chỉ tiêu X±SE Tổng số trứng (quả) 94,5±2,24 Khối lượng trứng (g) 45,4±0,24 Dài trứng (mm) 5,3±0,02 Rộng trứng (mm) 4,0±0,01 Chỉ số hình dáng (%) 75,9±0,29 Tỷ lệ trứng có phôi (%) 83,3±0,75 Tỷ lệ trứng nở (%)/trứng có phôi 85,3±0
Luận văn liên quan