Đề tài Ứng dụng công nghệ thông tin vào trong sinh học

Công cụ tìm kiếm các trình tự DNA, RNA, axitamin trong ngân hàng dữ liệu 1. Ngân hàng NCBI 2.Ngân hàng EBI Công cụ tìm kiếm trình tự DNA, RAN, protein tương đồng Công cụ dịch trình tự nucleotide sang trình tự axitamin IV. Công cụ sắp cặp trình tự và đa trình tự

ppt31 trang | Chia sẻ: ngtr9097 | Lượt xem: 2141 | Lượt tải: 2download
Bạn đang xem trước 20 trang tài liệu Đề tài Ứng dụng công nghệ thông tin vào trong sinh học, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BÁO CÁO CHUYÊN ĐỀ SỐ 5 GV: Ngô Công Thắng SV: Vũ Thị Thùy Linh NỘI DUNG Công cụ tìm kiếm các trình tự DNA, RNA, axitamin trong ngân hàng dữ liệu 1. Ngân hàng NCBI 2.Ngân hàng EBI Công cụ tìm kiếm trình tự DNA, RAN, protein tương đồng Công cụ dịch trình tự nucleotide sang trình tự axitamin IV. Công cụ sắp cặp trình tự và đa trình tự I.Công cụ tìm kiếm các trình tự DNA, RNA, axitamin trong ngân hàng dữ liệu Ngân hàng NCBI -Trang web: 2.Ngân hàng EBI -Trang web: II.Công cụ tìm kiếm trình tự DNA, RNA, protein tương đồng Ngân hàng NCBI -Trang web a.Tìm kiếm trình tự AND tương đồng Nhập trình tự AND cần tìm kiếm vào khung .Lựa chọn chức năng Blastn Ví dụ:tìm kiếm các trình tự tương đồng với đoạn AND sau: agaattccggatgaattatgaataaaaactag b.Tìm kiếm trình tự protein tương đồng Cop trình tự của Toxin vào tìm kiếm protein tương đồng III.Công cụ dịch trình tự nucleotide sang trình tự axitamin -Trang web: IV.Công cụ sắp cặp trình tự và đa trình tự 1.Công cụ sắp cặp trình tự -Trang web: 2. Công cụ sắp đa trình tự +Trang web: TÀI LIỆU THAM KHẢO -Bài giảng tin sinh học của Phan Trọng Nhật -Website: + + + + +

Các file đính kèm theo tài liệu này:

  • pptbáo cáo chuyên đề 5.linh.ppt
  • pptBÁO CÁO CHUYÊN ĐỀ 6.linh.ppt
  • pptBáo cáo chuyên đề 7.ppt
  • pptBÁO CÁO CHUYÊN ĐỀ 8.ppt
  • pptBÁO CÁO CHUYÊN ĐỀ 10.ppt
  • pptbaocaotinsinh.linh4.ppt
  • pptchuyende9.ppt
Luận văn liên quan